Mutagenetix > Incidental Mutation

Incidental Mutation 'R2842:Frem3'

254331

Institutional Source

Beutler Lab

Gene Symbol

Frem3

Ensembl Gene

ENSMUSG00000042353

Gene Name

Fras1 related extracellular matrix protein 3

Synonyms

LOC333315

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R2842 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80611080-80695356 bp(+) (GRCm38)

Type of Mutation

splice site (20 bp from exon)

DNA Base Change (assembly)

T to A at 80669349 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039695]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000039695

SMART Domains

Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Cadherin_3	369	515	9.5e-31	PFAM
Pfam:Cadherin_3	495	596	9.4e-20	PFAM
Pfam:Cadherin_3	637	786	4.2e-20	PFAM
Pfam:Cadherin_3	788	913	5.5e-23	PFAM
Pfam:Cadherin_3	998	1163	1.8e-20	PFAM
Pfam:Cadherin_3	1129	1254	1.3e-19	PFAM
Pfam:Cadherin_3	1250	1395	9.5e-34	PFAM
Pfam:Cadherin_3	1397	1508	2.7e-21	PFAM
Pfam:Cadherin_3	1493	1617	1.2e-27	PFAM
Pfam:Cadherin_3	1622	1748	4.8e-17	PFAM
Calx_beta	1754	1853	1.45e-7	SMART
Calx_beta	1866	1977	3.35e-12	SMART
Calx_beta	1991	2098	1.61e-5	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aplp2	C	T	9: 31,157,826	R569Q	probably benign	Het
Arl8a	T	C	1: 135,155,251	S181P	probably damaging	Het
Armc8	A	G	9: 99,505,681	S396P	probably benign	Het
Baz2b	A	G	2: 59,913,004	V1541A	probably benign	Het
Crebbp	G	A	16: 4,109,198	R628C	probably damaging	Het
Ep400	T	A	5: 110,698,815	K295*	probably null	Het
Gon4l	T	C	3: 88,895,487	V1135A	probably damaging	Het
Gprc5b	G	A	7: 118,984,079	T189M	possibly damaging	Het
Gucy2g	C	T	19: 55,240,947	C97Y	probably damaging	Het
Heatr5a	C	T	12: 51,955,477		probably null	Het
Heatr5a	T	A	12: 51,955,478	K225M	probably null	Het
Insr	A	G	8: 3,202,986	I391T	probably damaging	Het
Lce1e	T	A	3: 92,707,749	H97L	unknown	Het
Macf1	A	G	4: 123,376,417	V6647A	probably damaging	Het
Mast1	T	C	8: 84,923,908	R399G	probably damaging	Het
Mast4	C	A	13: 102,736,431	S1951I	probably benign	Het
Mdc1	C	T	17: 35,848,794	P648S	probably benign	Het
Mgam	T	C	6: 40,661,345	F410L	probably benign	Het
Nr2e1	T	C	10: 42,568,445	R223G	probably damaging	Het
Otud7b	G	A	3: 96,136,594	E19K	probably damaging	Het
Plce1	T	C	19: 38,524,283	S9P	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Plxna4	A	G	6: 32,215,631		probably null	Het
Prkag3	T	C	1: 74,741,175	I444V	probably benign	Het
Rsph10b	T	G	5: 143,979,892	V310G	possibly damaging	Het
Tmem225	T	C	9: 40,149,801	Y135H	probably damaging	Het
Tox2	G	A	2: 163,204,630		probably benign	Het
Ttc3	C	T	16: 94,431,998	P1003L	probably damaging	Het
Wfikkn2	G	A	11: 94,238,259	T352I	probably benign	Het

Other mutations in Frem3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Frem3	APN	8	80668810	missense	possibly damaging	0.75
IGL01019:Frem3	APN	8	80615134	missense	probably benign	0.02
IGL01470:Frem3	APN	8	80614315	missense	probably damaging	1.00
IGL01609:Frem3	APN	8	80612704	missense	probably benign	0.00
IGL01622:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01623:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01751:Frem3	APN	8	80615743	missense	probably benign	0.33
IGL02037:Frem3	APN	8	80611489	missense	probably benign	0.31
IGL02039:Frem3	APN	8	80612971	missense	probably damaging	1.00
IGL02084:Frem3	APN	8	80612443	missense	possibly damaging	0.95
IGL02124:Frem3	APN	8	80613094	missense	probably damaging	0.99
IGL02140:Frem3	APN	8	80614107	missense	possibly damaging	0.84
IGL02836:Frem3	APN	8	80614381	missense	probably benign
IGL03090:Frem3	APN	8	80618229	missense	probably benign	0.01
IGL03102:Frem3	APN	8	80613032	missense	possibly damaging	0.92
IGL03116:Frem3	APN	8	80612806	missense	possibly damaging	0.84
IGL03165:Frem3	APN	8	80612529	missense	probably benign	0.26
IGL03224:Frem3	APN	8	80613463	missense	probably damaging	1.00
IGL03401:Frem3	APN	8	80614541	missense	probably damaging	1.00
IGL03403:Frem3	APN	8	80611090	missense	probably benign	0.04
FR4340:Frem3	UTSW	8	80615241	small insertion	probably benign
FR4976:Frem3	UTSW	8	80615241	small insertion	probably benign
IGL02991:Frem3	UTSW	8	80668882	missense	probably damaging	1.00
IGL03052:Frem3	UTSW	8	80614530	missense	probably damaging	1.00
R0089:Frem3	UTSW	8	80615878	missense	possibly damaging	0.94
R0647:Frem3	UTSW	8	80615185	missense	probably damaging	1.00
R0690:Frem3	UTSW	8	80613952	missense	possibly damaging	0.84
R0766:Frem3	UTSW	8	80615322	missense	probably benign
R0834:Frem3	UTSW	8	80687008	missense	probably damaging	1.00
R0909:Frem3	UTSW	8	80663406	missense	probably benign	0.45
R1033:Frem3	UTSW	8	80695157	missense	probably benign	0.00
R1144:Frem3	UTSW	8	80611884	missense	probably benign	0.01
R1312:Frem3	UTSW	8	80615322	missense	probably benign
R1330:Frem3	UTSW	8	80668839	missense	probably damaging	0.99
R1355:Frem3	UTSW	8	80690702	missense	probably damaging	1.00
R1390:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R1413:Frem3	UTSW	8	80668801	missense	probably benign
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1503:Frem3	UTSW	8	80687018	missense	probably damaging	0.99
R1538:Frem3	UTSW	8	80612710	missense	probably damaging	1.00
R1538:Frem3	UTSW	8	80613135	missense	probably benign	0.00
R1612:Frem3	UTSW	8	80614861	missense	probably damaging	1.00
R1793:Frem3	UTSW	8	80613112	missense	probably benign	0.03
R1872:Frem3	UTSW	8	80612576	missense	probably damaging	1.00
R1879:Frem3	UTSW	8	80611938	nonsense	probably null
R1886:Frem3	UTSW	8	80613885	missense	probably benign	0.00
R1933:Frem3	UTSW	8	80612890	missense	probably benign	0.00
R2027:Frem3	UTSW	8	80695337	missense	possibly damaging	0.75
R2040:Frem3	UTSW	8	80615826	missense	possibly damaging	0.92
R2050:Frem3	UTSW	8	80614891	missense	probably damaging	1.00
R2079:Frem3	UTSW	8	80615103	missense	probably benign	0.03
R2099:Frem3	UTSW	8	80615859	missense	probably benign	0.06
R2120:Frem3	UTSW	8	80615457	missense	probably benign	0.20
R2845:Frem3	UTSW	8	80613220	missense	probably damaging	1.00
R3015:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R3442:Frem3	UTSW	8	80613040	missense	probably damaging	1.00
R3724:Frem3	UTSW	8	80615271	missense	probably benign	0.06
R3730:Frem3	UTSW	8	80615916	missense	probably damaging	0.99
R3939:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3940:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3941:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R4089:Frem3	UTSW	8	80615173	missense	probably damaging	1.00
R4282:Frem3	UTSW	8	80614141	missense	probably benign	0.00
R4437:Frem3	UTSW	8	80612607	missense	probably benign	0.30
R4480:Frem3	UTSW	8	80611357	missense	probably benign	0.10
R4575:Frem3	UTSW	8	80616075	missense	probably benign	0.17
R4583:Frem3	UTSW	8	80613514	missense	probably benign	0.03
R4620:Frem3	UTSW	8	80668957	missense	possibly damaging	0.82
R4621:Frem3	UTSW	8	80669191	splice site	probably null
R4644:Frem3	UTSW	8	80613727	missense	probably benign	0.33
R4667:Frem3	UTSW	8	80663420	missense	probably damaging	0.97
R4748:Frem3	UTSW	8	80611459	missense	probably damaging	1.00
R4823:Frem3	UTSW	8	80613958	missense	probably benign	0.25
R4836:Frem3	UTSW	8	80663397	missense	probably damaging	0.99
R4867:Frem3	UTSW	8	80613283	missense	probably damaging	1.00
R4921:Frem3	UTSW	8	80613136	missense	possibly damaging	0.83
R5030:Frem3	UTSW	8	80613247	missense	possibly damaging	0.89
R5035:Frem3	UTSW	8	80615914	missense	probably damaging	0.97
R5172:Frem3	UTSW	8	80612566	missense	probably benign	0.44
R5289:Frem3	UTSW	8	80612319	missense	probably benign	0.00
R5492:Frem3	UTSW	8	80612677	missense	probably damaging	1.00
R5655:Frem3	UTSW	8	80612694	missense	probably benign	0.00
R5685:Frem3	UTSW	8	80695303	missense	probably damaging	1.00
R5723:Frem3	UTSW	8	80613397	missense	probably benign	0.02
R5743:Frem3	UTSW	8	80615778	missense	probably damaging	0.98
R5889:Frem3	UTSW	8	80614288	missense	probably damaging	1.00
R6048:Frem3	UTSW	8	80613433	missense	probably benign	0.03
R6057:Frem3	UTSW	8	80615587	missense	probably damaging	0.99
R6137:Frem3	UTSW	8	80615047	missense	probably benign
R6264:Frem3	UTSW	8	80615203	missense	probably damaging	1.00
R6339:Frem3	UTSW	8	80613015	missense	possibly damaging	0.84
R6418:Frem3	UTSW	8	80611152	missense	probably benign	0.08
R6680:Frem3	UTSW	8	80669320	missense	probably damaging	1.00
R6773:Frem3	UTSW	8	80611815	missense	probably damaging	1.00
R6838:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R6928:Frem3	UTSW	8	80611282	missense	possibly damaging	0.48
R6939:Frem3	UTSW	8	80615145	missense	probably benign	0.23
R6995:Frem3	UTSW	8	80612579	missense	probably damaging	0.98
R7112:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7155:Frem3	UTSW	8	80616039	missense	probably benign	0.01
R7235:Frem3	UTSW	8	80690725	missense	probably benign	0.00
R7282:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7403:Frem3	UTSW	8	80616145	missense	probably damaging	1.00
R7422:Frem3	UTSW	8	80615763	missense	probably benign	0.00
R7485:Frem3	UTSW	8	80613336	missense	probably damaging	1.00
R7516:Frem3	UTSW	8	80612083	missense	probably damaging	0.99
R7858:Frem3	UTSW	8	80611721	nonsense	probably null
R7976:Frem3	UTSW	8	80611602	nonsense	probably null
R8171:Frem3	UTSW	8	80615240	missense	probably damaging	1.00
R8185:Frem3	UTSW	8	80612304	nonsense	probably null
R8306:Frem3	UTSW	8	80612211	missense	possibly damaging	0.95
R8478:Frem3	UTSW	8	80611558	missense	probably damaging	1.00
R8518:Frem3	UTSW	8	80612595	missense	probably damaging	1.00
R8794:Frem3	UTSW	8	80612278	missense	probably damaging	1.00
R8794:Frem3	UTSW	8	80616222	missense	probably benign	0.02
R8806:Frem3	UTSW	8	80663435	missense	probably benign	0.30
R8833:Frem3	UTSW	8	80612772	missense	probably benign	0.29
R8879:Frem3	UTSW	8	80613148	missense	probably damaging	0.98
R8897:Frem3	UTSW	8	80612790	missense	probably damaging	1.00
R8983:Frem3	UTSW	8	80669246	missense	probably damaging	1.00
R9207:Frem3	UTSW	8	80613442	missense	possibly damaging	0.73
R9277:Frem3	UTSW	8	80690773	missense	probably damaging	0.96
R9536:Frem3	UTSW	8	80615419	missense	probably benign	0.00
R9596:Frem3	UTSW	8	80615322	missense	probably benign
R9649:Frem3	UTSW	8	80614516	missense	probably damaging	1.00
R9671:Frem3	UTSW	8	80612505	missense	probably benign	0.00
R9723:Frem3	UTSW	8	80614723	missense	probably benign
R9790:Frem3	UTSW	8	80613261	missense	probably benign	0.01
R9791:Frem3	UTSW	8	80613261	missense	probably benign	0.01
RF030:Frem3	UTSW	8	80615238	small insertion	probably benign
RF034:Frem3	UTSW	8	80615238	small insertion	probably benign
RF042:Frem3	UTSW	8	80615238	small insertion	probably benign
X0024:Frem3	UTSW	8	80613081	missense	possibly damaging	0.76
X0027:Frem3	UTSW	8	80612388	nonsense	probably null
Z1088:Frem3	UTSW	8	80615426	missense	probably benign	0.04
Z1176:Frem3	UTSW	8	80611503	missense	probably damaging	0.99
Z1176:Frem3	UTSW	8	80615431	missense	probably benign	0.03
Z1177:Frem3	UTSW	8	80616129	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TGCTGAAATGTCTTCTCTGGTC -3'
(R):5'- GCTGAGAGCAGGCATTCTTG -3'

Sequencing Primer
(F):5'- CTCTGGTCTTTTCTAGAATCAACAG -3'
(R):5'- TATCTCTGCTCGAAGGAGACC -3'

Posted On

2014-12-04