Incidental Mutation 'R2842:Armc8'
ID254341
Institutional Source Beutler Lab
Gene Symbol Armc8
Ensembl Gene ENSMUSG00000032468
Gene Namearmadillo repeat containing 8
Synonyms1200015K23Rik, HSPC056, Gid5
Accession Numbers

Genbank: NM_028768; MGI: 1921375

Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R2842 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99478372-99568899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99505681 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 396 (S396P)
Ref Sequence ENSEMBL: ENSMUSP00000035043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035043]
Predicted Effect probably benign
Transcript: ENSMUST00000035043
AA Change: S396P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035043
Gene: ENSMUSG00000032468
AA Change: S396P

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
ARM 177 217 2.04e1 SMART
ARM 372 413 3.58e1 SMART
Blast:ARM 414 455 7e-17 BLAST
ARM 457 497 3.81e-1 SMART
ARM 500 540 5.43e1 SMART
Blast:ARM 542 585 1e-20 BLAST
Blast:ARM 633 673 1e-16 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
Arl8a T C 1: 135,155,251 S181P probably damaging Het
Baz2b A G 2: 59,913,004 V1541A probably benign Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Ep400 T A 5: 110,698,815 K295* probably null Het
Frem3 T A 8: 80,669,349 probably null Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gprc5b G A 7: 118,984,079 T189M possibly damaging Het
Gucy2g C T 19: 55,240,947 C97Y probably damaging Het
Heatr5a C T 12: 51,955,477 probably null Het
Heatr5a T A 12: 51,955,478 K225M probably null Het
Insr A G 8: 3,202,986 I391T probably damaging Het
Lce1e T A 3: 92,707,749 H97L unknown Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mast1 T C 8: 84,923,908 R399G probably damaging Het
Mast4 C A 13: 102,736,431 S1951I probably benign Het
Mdc1 C T 17: 35,848,794 P648S probably benign Het
Mgam T C 6: 40,661,345 F410L probably benign Het
Nr2e1 T C 10: 42,568,445 R223G probably damaging Het
Otud7b G A 3: 96,136,594 E19K probably damaging Het
Plce1 T C 19: 38,524,283 S9P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxna4 A G 6: 32,215,631 probably null Het
Prkag3 T C 1: 74,741,175 I444V probably benign Het
Rsph10b T G 5: 143,979,892 V310G possibly damaging Het
Tmem225 T C 9: 40,149,801 Y135H probably damaging Het
Tox2 G A 2: 163,204,630 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Wfikkn2 G A 11: 94,238,259 T352I probably benign Het
Other mutations in Armc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Armc8 APN 9 99505734 critical splice acceptor site probably null
IGL00951:Armc8 APN 9 99505704 missense probably benign 0.00
IGL01776:Armc8 APN 9 99526883 splice site probably benign
IGL02215:Armc8 APN 9 99483978 missense possibly damaging 0.92
IGL02244:Armc8 APN 9 99483174 missense probably benign 0.10
IGL02610:Armc8 APN 9 99527069 splice site probably benign
IGL02612:Armc8 APN 9 99527069 splice site probably benign
IGL02615:Armc8 APN 9 99527069 splice site probably benign
IGL02619:Armc8 APN 9 99527069 splice site probably benign
IGL02621:Armc8 APN 9 99527069 splice site probably benign
IGL02622:Armc8 APN 9 99527069 splice site probably benign
IGL02623:Armc8 APN 9 99527069 splice site probably benign
IGL02624:Armc8 APN 9 99527069 splice site probably benign
D4043:Armc8 UTSW 9 99483976 missense probably benign 0.13
R0321:Armc8 UTSW 9 99533177 missense probably damaging 0.99
R0498:Armc8 UTSW 9 99497292 missense probably damaging 1.00
R0646:Armc8 UTSW 9 99505688 missense probably damaging 1.00
R0658:Armc8 UTSW 9 99536158 splice site probably benign
R1061:Armc8 UTSW 9 99537731 missense probably damaging 1.00
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1429:Armc8 UTSW 9 99536207 missense possibly damaging 0.67
R1432:Armc8 UTSW 9 99523132 splice site probably benign
R1538:Armc8 UTSW 9 99505290 missense probably damaging 0.96
R1606:Armc8 UTSW 9 99537729 missense probably damaging 0.98
R1817:Armc8 UTSW 9 99536259 missense possibly damaging 0.67
R1866:Armc8 UTSW 9 99536280 missense probably benign
R2015:Armc8 UTSW 9 99483105 nonsense probably null
R2143:Armc8 UTSW 9 99505308 missense probably damaging 0.99
R2251:Armc8 UTSW 9 99502600 critical splice acceptor site probably null
R3010:Armc8 UTSW 9 99487913 missense probably benign 0.06
R3709:Armc8 UTSW 9 99520497 missense probably damaging 1.00
R4440:Armc8 UTSW 9 99484034 missense probably benign 0.37
R4865:Armc8 UTSW 9 99526889 critical splice donor site probably null
R5492:Armc8 UTSW 9 99527131 nonsense probably null
R5606:Armc8 UTSW 9 99536262 missense probably benign 0.23
R5639:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5693:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5694:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5698:Armc8 UTSW 9 99535820 missense probably benign 0.12
R5700:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5701:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5735:Armc8 UTSW 9 99497394 critical splice acceptor site probably null
R6314:Armc8 UTSW 9 99535884 missense probably benign 0.28
R7034:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7036:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7393:Armc8 UTSW 9 99483999 missense possibly damaging 0.47
R7395:Armc8 UTSW 9 99533132 missense probably damaging 0.99
R7937:Armc8 UTSW 9 99536219 missense probably damaging 0.98
R8130:Armc8 UTSW 9 99551547 missense probably benign 0.02
R8373:Armc8 UTSW 9 99527099 missense probably benign 0.02
Z1177:Armc8 UTSW 9 99497386 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAGCAAGACACCTCTCGG -3'
(R):5'- CTGCAAAGTGATTGTCGAGAG -3'

Sequencing Primer
(F):5'- AAGACACCTCTCGGGCGTTG -3'
(R):5'- TGTCGAGAGGTAAAATCTTTTGC -3'
Posted On2014-12-04