Incidental Mutation 'R2842:Wfikkn2'
ID 254345
Institutional Source Beutler Lab
Gene Symbol Wfikkn2
Ensembl Gene ENSMUSG00000044177
Gene Name WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Synonyms 2610304F08Rik, Gasp1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2842 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 94126782-94136831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 94129085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 352 (T352I)
Ref Sequence ENSEMBL: ENSMUSP00000053238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061469]
AlphaFold Q7TQN3
Predicted Effect probably benign
Transcript: ENSMUST00000061469
AA Change: T352I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000053238
Gene: ENSMUSG00000044177
AA Change: T352I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WAP 37 87 1.77e-3 SMART
low complexity region 91 102 N/A INTRINSIC
KAZAL 128 170 1.5e-2 SMART
low complexity region 179 192 N/A INTRINSIC
IGc2 217 289 1.3e-11 SMART
KU 321 374 2e-14 SMART
KU 379 432 2.79e-27 SMART
Pfam:NTR 451 556 2.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131352
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WFIKKN1 protein contains a WAP domain, follistatin domain, immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. This gene encodes a WFIKKN1-related protein which has the same domain organization as the WFIKKN1 protein. The WAP-type, follistatin type, Kunitz-type, and NTR-type protease inhibitory domains may control the action of multiple types of proteases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,069,122 (GRCm39) R569Q probably benign Het
Arl8a T C 1: 135,082,989 (GRCm39) S181P probably damaging Het
Armc8 A G 9: 99,387,734 (GRCm39) S396P probably benign Het
Baz2b A G 2: 59,743,348 (GRCm39) V1541A probably benign Het
Crebbp G A 16: 3,927,062 (GRCm39) R628C probably damaging Het
Ep400 T A 5: 110,846,681 (GRCm39) K295* probably null Het
Frem3 T A 8: 81,395,978 (GRCm39) probably null Het
Gon4l T C 3: 88,802,794 (GRCm39) V1135A probably damaging Het
Gprc5b G A 7: 118,583,302 (GRCm39) T189M possibly damaging Het
Gucy2g C T 19: 55,229,379 (GRCm39) C97Y probably damaging Het
Heatr5a T A 12: 52,002,261 (GRCm39) K225M probably null Het
Heatr5a C T 12: 52,002,260 (GRCm39) probably null Het
Insr A G 8: 3,252,986 (GRCm39) I391T probably damaging Het
Lce1e T A 3: 92,615,056 (GRCm39) H97L unknown Het
Macf1 A G 4: 123,270,210 (GRCm39) V6647A probably damaging Het
Mast1 T C 8: 85,650,537 (GRCm39) R399G probably damaging Het
Mast4 C A 13: 102,872,939 (GRCm39) S1951I probably benign Het
Mdc1 C T 17: 36,159,686 (GRCm39) P648S probably benign Het
Mgam T C 6: 40,638,279 (GRCm39) F410L probably benign Het
Nr2e1 T C 10: 42,444,441 (GRCm39) R223G probably damaging Het
Otud7b G A 3: 96,043,905 (GRCm39) E19K probably damaging Het
Plce1 T C 19: 38,512,727 (GRCm39) S9P probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Plxna4 A G 6: 32,192,566 (GRCm39) probably null Het
Prkag3 T C 1: 74,780,334 (GRCm39) I444V probably benign Het
Rsph10b T G 5: 143,916,710 (GRCm39) V310G possibly damaging Het
Tmem225 T C 9: 40,061,097 (GRCm39) Y135H probably damaging Het
Tox2 G A 2: 163,046,550 (GRCm39) probably benign Het
Ttc3 C T 16: 94,232,857 (GRCm39) P1003L probably damaging Het
Other mutations in Wfikkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Wfikkn2 APN 11 94,128,921 (GRCm39) nonsense probably null
R1269:Wfikkn2 UTSW 11 94,129,301 (GRCm39) missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94,129,721 (GRCm39) missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94,129,721 (GRCm39) missense probably damaging 1.00
R1519:Wfikkn2 UTSW 11 94,128,933 (GRCm39) missense probably benign 0.00
R1584:Wfikkn2 UTSW 11 94,129,721 (GRCm39) missense probably damaging 1.00
R1856:Wfikkn2 UTSW 11 94,128,949 (GRCm39) nonsense probably null
R2026:Wfikkn2 UTSW 11 94,129,779 (GRCm39) missense possibly damaging 0.93
R4738:Wfikkn2 UTSW 11 94,129,902 (GRCm39) missense probably benign 0.00
R4833:Wfikkn2 UTSW 11 94,129,878 (GRCm39) missense probably benign 0.09
R5087:Wfikkn2 UTSW 11 94,129,173 (GRCm39) missense probably damaging 1.00
R5775:Wfikkn2 UTSW 11 94,129,114 (GRCm39) missense probably benign 0.22
R5966:Wfikkn2 UTSW 11 94,129,688 (GRCm39) missense probably damaging 1.00
R6842:Wfikkn2 UTSW 11 94,128,866 (GRCm39) missense probably damaging 0.96
R7539:Wfikkn2 UTSW 11 94,133,185 (GRCm39) missense probably damaging 1.00
R7544:Wfikkn2 UTSW 11 94,128,738 (GRCm39) missense probably benign 0.09
R7849:Wfikkn2 UTSW 11 94,129,810 (GRCm39) missense probably benign 0.01
R7879:Wfikkn2 UTSW 11 94,129,755 (GRCm39) missense probably damaging 1.00
R8299:Wfikkn2 UTSW 11 94,129,890 (GRCm39) missense probably damaging 1.00
R9312:Wfikkn2 UTSW 11 94,129,497 (GRCm39) missense probably damaging 0.97
R9752:Wfikkn2 UTSW 11 94,129,211 (GRCm39) missense probably benign 0.17
Z1176:Wfikkn2 UTSW 11 94,129,227 (GRCm39) missense not run
Z1176:Wfikkn2 UTSW 11 94,128,478 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGTTACCGTTGCCCTCACAG -3'
(R):5'- AAATGTCGCTGGTGTCCTGAG -3'

Sequencing Primer
(F):5'- CCGCCATAGACGAAGGACTG -3'
(R):5'- TGTCCTGAGGGCTGACTTCC -3'
Posted On 2014-12-04