Incidental Mutation 'R2842:Ttc3'
List |< first << previous [record 29 of 30] next >> last >|
ID254357
Institutional Source Beutler Lab
Gene Symbol Ttc3
Ensembl Gene ENSMUSG00000040785
Gene Nametetratricopeptide repeat domain 3
Synonyms2610202A04Rik, D16Ium21, D16Ium21e, TPRD
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.642) question?
Stock #R2842 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location94370618-94469343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94431998 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1003 (P1003L)
Ref Sequence ENSEMBL: ENSMUSP00000122724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000122895] [ENSMUST00000143145] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153988] [ENSMUST00000155692] [ENSMUST00000232395] [ENSMUST00000231569] [ENSMUST00000232660] [ENSMUST00000231915] [ENSMUST00000231850]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101881
Predicted Effect probably damaging
Transcript: ENSMUST00000117648
AA Change: P984L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785
AA Change: P984L

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122895
AA Change: P966L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785
AA Change: P966L

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141176
AA Change: P182L
SMART Domains Protein: ENSMUSP00000114483
Gene: ENSMUSG00000040785
AA Change: P182L

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
coiled coil region 72 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably benign
Transcript: ENSMUST00000147046
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147352
AA Change: P966L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785
AA Change: P966L

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150346
AA Change: P583L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785
AA Change: P583L

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151770
AA Change: P984L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785
AA Change: P984L

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152117
AA Change: P583L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785
AA Change: P583L

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153988
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155692
AA Change: P1003L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785
AA Change: P1003L

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232395
AA Change: P984L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231569
AA Change: P629L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000232660
AA Change: P984L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231915
Predicted Effect probably benign
Transcript: ENSMUST00000231850
Meta Mutation Damage Score 0.4526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
Arl8a T C 1: 135,155,251 S181P probably damaging Het
Armc8 A G 9: 99,505,681 S396P probably benign Het
Baz2b A G 2: 59,913,004 V1541A probably benign Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Ep400 T A 5: 110,698,815 K295* probably null Het
Frem3 T A 8: 80,669,349 probably null Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gprc5b G A 7: 118,984,079 T189M possibly damaging Het
Gucy2g C T 19: 55,240,947 C97Y probably damaging Het
Heatr5a T A 12: 51,955,478 K225M probably null Het
Heatr5a C T 12: 51,955,477 probably null Het
Insr A G 8: 3,202,986 I391T probably damaging Het
Lce1e T A 3: 92,707,749 H97L unknown Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mast1 T C 8: 84,923,908 R399G probably damaging Het
Mast4 C A 13: 102,736,431 S1951I probably benign Het
Mdc1 C T 17: 35,848,794 P648S probably benign Het
Mgam T C 6: 40,661,345 F410L probably benign Het
Nr2e1 T C 10: 42,568,445 R223G probably damaging Het
Otud7b G A 3: 96,136,594 E19K probably damaging Het
Plce1 T C 19: 38,524,283 S9P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxna4 A G 6: 32,215,631 probably null Het
Prkag3 T C 1: 74,741,175 I444V probably benign Het
Rsph10b T G 5: 143,979,892 V310G possibly damaging Het
Tmem225 T C 9: 40,149,801 Y135H probably damaging Het
Tox2 G A 2: 163,204,630 probably benign Het
Wfikkn2 G A 11: 94,238,259 T352I probably benign Het
Other mutations in Ttc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ttc3 APN 16 94426761 splice site probably null
IGL00979:Ttc3 APN 16 94456718 missense probably damaging 1.00
IGL01520:Ttc3 APN 16 94390207 missense probably benign 0.04
IGL01663:Ttc3 APN 16 94409731 critical splice donor site probably null
IGL01720:Ttc3 APN 16 94385369 missense probably damaging 0.99
IGL01736:Ttc3 APN 16 94442527 missense probably damaging 0.99
IGL02045:Ttc3 APN 16 94409681 splice site probably benign
IGL02203:Ttc3 APN 16 94418598 splice site probably benign
IGL02327:Ttc3 APN 16 94448108 missense probably damaging 1.00
IGL02794:Ttc3 APN 16 94467926 missense probably damaging 1.00
IGL02898:Ttc3 APN 16 94419426 missense probably damaging 1.00
PIT4378001:Ttc3 UTSW 16 94410906 missense probably benign 0.01
R0064:Ttc3 UTSW 16 94422247 missense possibly damaging 0.79
R0098:Ttc3 UTSW 16 94390265 missense probably benign 0.02
R0112:Ttc3 UTSW 16 94385322 splice site probably benign
R0135:Ttc3 UTSW 16 94462268 missense possibly damaging 0.92
R0480:Ttc3 UTSW 16 94432004 nonsense probably null
R0513:Ttc3 UTSW 16 94426212 missense probably damaging 1.00
R0532:Ttc3 UTSW 16 94387330 splice site probably benign
R0607:Ttc3 UTSW 16 94456785 nonsense probably null
R0742:Ttc3 UTSW 16 94459880 missense probably benign 0.23
R0905:Ttc3 UTSW 16 94456789 nonsense probably null
R1118:Ttc3 UTSW 16 94416268 splice site probably benign
R1355:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1370:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1486:Ttc3 UTSW 16 94448129 missense probably damaging 1.00
R1598:Ttc3 UTSW 16 94422297 missense probably damaging 1.00
R1641:Ttc3 UTSW 16 94443317 missense probably benign 0.19
R2092:Ttc3 UTSW 16 94442832 missense probably benign 0.02
R2232:Ttc3 UTSW 16 94459972 missense probably benign 0.00
R2339:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2342:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R3117:Ttc3 UTSW 16 94442563 missense possibly damaging 0.51
R4194:Ttc3 UTSW 16 94422277 missense probably damaging 0.99
R4329:Ttc3 UTSW 16 94466961 missense probably damaging 1.00
R4431:Ttc3 UTSW 16 94410958 critical splice donor site probably null
R4530:Ttc3 UTSW 16 94466877 intron probably benign
R4531:Ttc3 UTSW 16 94466877 intron probably benign
R4532:Ttc3 UTSW 16 94466877 intron probably benign
R4533:Ttc3 UTSW 16 94466877 intron probably benign
R4588:Ttc3 UTSW 16 94442901 missense probably benign 0.01
R4625:Ttc3 UTSW 16 94388272 nonsense probably null
R4676:Ttc3 UTSW 16 94442761 missense probably damaging 1.00
R4700:Ttc3 UTSW 16 94439241 splice site probably null
R4856:Ttc3 UTSW 16 94390283 missense probably benign 0.32
R4867:Ttc3 UTSW 16 94454515 missense probably damaging 0.96
R4885:Ttc3 UTSW 16 94419465 missense probably damaging 1.00
R4885:Ttc3 UTSW 16 94426831 critical splice donor site probably null
R4899:Ttc3 UTSW 16 94429455 missense probably damaging 1.00
R4997:Ttc3 UTSW 16 94452982 missense probably damaging 1.00
R5023:Ttc3 UTSW 16 94429359 missense probably benign 0.01
R5105:Ttc3 UTSW 16 94466934 missense possibly damaging 0.94
R5205:Ttc3 UTSW 16 94448059 missense probably benign 0.07
R5287:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5338:Ttc3 UTSW 16 94384041 missense probably damaging 0.99
R5347:Ttc3 UTSW 16 94429620 missense probably damaging 1.00
R5403:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5460:Ttc3 UTSW 16 94457382 missense probably benign 0.32
R5739:Ttc3 UTSW 16 94439324 nonsense probably null
R6242:Ttc3 UTSW 16 94442695 missense probably benign 0.04
R6253:Ttc3 UTSW 16 94457413 critical splice donor site probably null
R6455:Ttc3 UTSW 16 94418623 start codon destroyed probably null 0.83
R6559:Ttc3 UTSW 16 94422349 critical splice donor site probably null
R6564:Ttc3 UTSW 16 94442611 missense probably damaging 1.00
R6932:Ttc3 UTSW 16 94443453 missense probably benign
R7331:Ttc3 UTSW 16 94394359 missense probably benign 0.27
R7497:Ttc3 UTSW 16 94418682 missense possibly damaging 0.93
R7610:Ttc3 UTSW 16 94427838 missense probably benign 0.11
R7738:Ttc3 UTSW 16 94387382 missense probably benign 0.00
R7970:Ttc3 UTSW 16 94457364 missense probably damaging 1.00
R8052:Ttc3 UTSW 16 94467989 missense probably benign 0.09
R8087:Ttc3 UTSW 16 94442953 missense probably benign 0.00
R8309:Ttc3 UTSW 16 94466979 missense probably damaging 1.00
R8320:Ttc3 UTSW 16 94418676 missense probably damaging 1.00
R8322:Ttc3 UTSW 16 94454492 missense probably damaging 1.00
R8518:Ttc3 UTSW 16 94457379 missense probably benign 0.21
X0022:Ttc3 UTSW 16 94442525 missense probably benign 0.00
Y5378:Ttc3 UTSW 16 94412129 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACGGAGCATCTCTCAAGGAG -3'
(R):5'- AAGGCTGGGACCTTTCTTTC -3'

Sequencing Primer
(F):5'- CAAGGAGCTTGATTTCCACG -3'
(R):5'- AGGCTGGGACCTTTCTTTCAAGTC -3'
Posted On2014-12-04