Incidental Mutation 'R2843:Zbtb8os'
ID254375
Institutional Source Beutler Lab
Gene Symbol Zbtb8os
Ensembl Gene ENSMUSG00000057572
Gene Namezinc finger and BTB domain containing 8 opposite strand
SynonymsArch, 2010001H09Rik, 2310028N13Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R2843 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location129335695-129354547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129341516 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 54 (E54D)
Ref Sequence ENSEMBL: ENSMUSP00000113004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119480] [ENSMUST00000141235] [ENSMUST00000146767]
Predicted Effect unknown
Transcript: ENSMUST00000106047
AA Change: N44I
Predicted Effect probably damaging
Transcript: ENSMUST00000119480
AA Change: E54D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113004
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 119 4.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140272
Predicted Effect probably damaging
Transcript: ENSMUST00000141235
AA Change: E54D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120925
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 167 3.3e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146767
AA Change: E54D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114628
Gene: ENSMUSG00000057572
AA Change: E54D

DomainStartEndE-ValueType
Pfam:Archease 31 145 3.5e-40 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,364,634 E4G possibly damaging Het
Afm C T 5: 90,526,465 R279* probably null Het
Fbxw7 G A 3: 84,976,220 R486Q probably damaging Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Hmg20b G C 10: 81,346,570 R209G probably benign Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Jade1 T C 3: 41,604,845 Y454H probably damaging Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Pdlim2 C T 14: 70,166,100 V288I probably benign Het
Pknox2 T C 9: 36,894,328 N395S probably benign Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Rad51 T C 2: 119,118,633 V38A probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Vmn2r18 T A 5: 151,562,284 T582S probably damaging Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in Zbtb8os
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0597:Zbtb8os UTSW 4 129346877 missense probably damaging 1.00
R2844:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R2845:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R2846:Zbtb8os UTSW 4 129341516 missense probably damaging 0.99
R4132:Zbtb8os UTSW 4 129336113 missense probably damaging 1.00
R4714:Zbtb8os UTSW 4 129341764 missense probably damaging 0.98
R5138:Zbtb8os UTSW 4 129346926 intron probably benign
R5579:Zbtb8os UTSW 4 129340735 missense probably damaging 0.99
R6019:Zbtb8os UTSW 4 129340749 missense possibly damaging 0.93
R6265:Zbtb8os UTSW 4 129335982 start gained probably benign
R6365:Zbtb8os UTSW 4 129343152 missense possibly damaging 0.89
Z1176:Zbtb8os UTSW 4 129341521 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGGGTGTCGTCAAATTAGACATGTAG -3'
(R):5'- TCGTCCCCTACAGAGTGGAAAG -3'

Sequencing Primer
(F):5'- CACATACTGTGGCCTCTT -3'
(R):5'- GTTCAGAATCCACCCTGAGG -3'
Posted On2014-12-04