Mutagenetix > Incidental Mutation

Incidental Mutation 'R2843:Zbtb8os'

254375

Institutional Source

Beutler Lab

Gene Symbol

Zbtb8os

Ensembl Gene

ENSMUSG00000057572

Gene Name

zinc finger and BTB domain containing 8 opposite strand

Synonyms

Arch, 2010001H09Rik, 2310028N13Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R2843 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129229325-129243664 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 129235309 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 54 (E54D)

Ref Sequence

ENSEMBL: ENSMUSP00000113004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119480] [ENSMUST00000141235] [ENSMUST00000146767]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000106047
AA Change: N44I

Predicted Effect

probably damaging
Transcript: ENSMUST00000119480
AA Change: E54D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113004
Gene: ENSMUSG00000057572
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Archease	31	119	4.6e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140272

Predicted Effect

probably damaging
Transcript: ENSMUST00000141235
AA Change: E54D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120925
Gene: ENSMUSG00000057572
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Archease	31	167	3.3e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000146767
AA Change: E54D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000114628
Gene: ENSMUSG00000057572
AA Change: E54D

Domain	Start	End	E-Value	Type
Pfam:Archease	31	145	3.5e-40	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afm	C	T	5: 90,674,324 (GRCm39)	R279*	probably null	Het
Arhgef18	A	G	8: 3,414,634 (GRCm39)	E4G	possibly damaging	Het
Fbxw7	G	A	3: 84,883,527 (GRCm39)	R486Q	probably damaging	Het
Fhad1	G	T	4: 141,632,279 (GRCm39)	Q1287K	probably benign	Het
Hmg20b	G	C	10: 81,182,404 (GRCm39)	R209G	probably benign	Het
Hydin	T	C	8: 111,245,746 (GRCm39)	V2153A	probably benign	Het
Jade1	T	C	3: 41,559,280 (GRCm39)	Y454H	probably damaging	Het
Kcnn3	CGCAGCAGCAGCAGCAGCAGCAG	CGCAGCAGCAGCAGCAGCAG	3: 89,427,972 (GRCm39)		probably benign	Het
Pdlim2	C	T	14: 70,403,549 (GRCm39)	V288I	probably benign	Het
Pknox2	T	C	9: 36,805,624 (GRCm39)	N395S	probably benign	Het
Ppfia3	C	A	7: 45,005,852 (GRCm39)	R348L	probably damaging	Het
Rad51	T	C	2: 118,949,114 (GRCm39)	V38A	probably benign	Het
Sla2	G	A	2: 156,717,862 (GRCm39)	R137C	probably damaging	Het
Slc15a4	A	G	5: 127,681,600 (GRCm39)		probably null	Het
Vmn2r18	T	A	5: 151,485,749 (GRCm39)	T582S	probably damaging	Het
Zfp84	T	G	7: 29,474,758 (GRCm39)		probably null	Het

Other mutations in Zbtb8os

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0597:Zbtb8os	UTSW	4	129,240,670 (GRCm39)	missense	probably damaging	1.00
R2844:Zbtb8os	UTSW	4	129,235,309 (GRCm39)	missense	probably damaging	0.99
R2845:Zbtb8os	UTSW	4	129,235,309 (GRCm39)	missense	probably damaging	0.99
R2846:Zbtb8os	UTSW	4	129,235,309 (GRCm39)	missense	probably damaging	0.99
R4132:Zbtb8os	UTSW	4	129,229,906 (GRCm39)	missense	probably damaging	1.00
R4714:Zbtb8os	UTSW	4	129,235,557 (GRCm39)	missense	probably damaging	0.98
R5138:Zbtb8os	UTSW	4	129,240,719 (GRCm39)	intron	probably benign
R5579:Zbtb8os	UTSW	4	129,234,528 (GRCm39)	missense	probably damaging	0.99
R6019:Zbtb8os	UTSW	4	129,234,542 (GRCm39)	missense	possibly damaging	0.93
R6265:Zbtb8os	UTSW	4	129,229,775 (GRCm39)	start gained	probably benign
R6365:Zbtb8os	UTSW	4	129,236,945 (GRCm39)	missense	possibly damaging	0.89
R8884:Zbtb8os	UTSW	4	129,236,924 (GRCm39)	missense	probably benign	0.17
Z1176:Zbtb8os	UTSW	4	129,235,314 (GRCm39)	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- ATGGGTGTCGTCAAATTAGACATGTAG -3'
(R):5'- TCGTCCCCTACAGAGTGGAAAG -3'

Sequencing Primer
(F):5'- CACATACTGTGGCCTCTT -3'
(R):5'- GTTCAGAATCCACCCTGAGG -3'

Posted On

2014-12-04