Incidental Mutation 'R0317:Cela2a'
ID 25439
Institutional Source Beutler Lab
Gene Symbol Cela2a
Ensembl Gene ENSMUSG00000058579
Gene Name chymotrypsin-like elastase family, member 2A
Synonyms Ela-2, Ela2, Ela2a
MMRRC Submission 038527-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R0317 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 141814962-141826160 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 141821700 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102481]
AlphaFold P05208
Predicted Effect probably null
Transcript: ENSMUST00000102481
SMART Domains Protein: ENSMUSP00000099539
Gene: ENSMUSG00000058579

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 30 264 2.75e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155826
Predicted Effect probably benign
Transcript: ENSMUST00000176781
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease enzyme that hydrolyzes elastin. This gene is highly expressed in the pancreatic acinar cells where the encoded preproprotein undergoes processing including signal peptide cleavage to generate an inactive zymogen. The removal of N-terminal activation peptide from the zymogen by trypsin generates active elastase enzyme. This gene is also expressed in the mouse epidermis where it participates in pro-filaggrin processing. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Cela2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Cela2a APN 4 141821454 missense probably damaging 1.00
R1372:Cela2a UTSW 4 141819094 missense probably damaging 1.00
R1619:Cela2a UTSW 4 141825941 critical splice donor site probably null
R1719:Cela2a UTSW 4 141817946 missense probably damaging 0.98
R2155:Cela2a UTSW 4 141818039 splice site probably null
R2323:Cela2a UTSW 4 141826079 intron probably benign
R4705:Cela2a UTSW 4 141821411 missense probably benign 0.00
R4851:Cela2a UTSW 4 141825591 missense probably benign 0.03
R4880:Cela2a UTSW 4 141822287 missense probably benign 0.01
R5704:Cela2a UTSW 4 141825988 intron probably benign
R5809:Cela2a UTSW 4 141825553 missense probably benign 0.00
R6710:Cela2a UTSW 4 141822243 missense probably damaging 1.00
R7946:Cela2a UTSW 4 141822306 missense possibly damaging 0.74
RF011:Cela2a UTSW 4 141821715 missense probably benign
Z1176:Cela2a UTSW 4 141821391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAATGTCATAGCTGGGTCAGG -3'
(R):5'- TCCATACACAGCACTGCACTGAATG -3'

Sequencing Primer
(F):5'- AAGTGTTTTGACTCTACCCGTC -3'
(R):5'- CCTGGGATAACCAGTAATGGTTC -3'
Posted On 2013-04-16