Incidental Mutation 'R2843:A430078G23Rik'
ID254391
Institutional Source Beutler Lab
Gene Symbol A430078G23Rik
Ensembl Gene ENSMUSG00000074497
Gene NameRIKEN cDNA A430078G23 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2843 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3353415-3390299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3364634 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 4 (E4G)
Ref Sequence ENSEMBL: ENSMUSP00000096566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098966] [ENSMUST00000208363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098966
AA Change: E4G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096566
Gene: ENSMUSG00000074497
AA Change: E4G

DomainStartEndE-ValueType
low complexity region 116 134 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208845
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afm C T 5: 90,526,465 R279* probably null Het
Fbxw7 G A 3: 84,976,220 R486Q probably damaging Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Hmg20b G C 10: 81,346,570 R209G probably benign Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Jade1 T C 3: 41,604,845 Y454H probably damaging Het
Kcnn3 CGCAGCAGCAGCAGCAGCAGCAG CGCAGCAGCAGCAGCAGCAG 3: 89,520,665 probably benign Het
Pdlim2 C T 14: 70,166,100 V288I probably benign Het
Pknox2 T C 9: 36,894,328 N395S probably benign Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Rad51 T C 2: 119,118,633 V38A probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Vmn2r18 T A 5: 151,562,284 T582S probably damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp84 T G 7: 29,775,333 probably null Het
Other mutations in A430078G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:A430078G23Rik APN 8 3381942 missense possibly damaging 0.62
IGL01743:A430078G23Rik APN 8 3364697 missense probably benign 0.01
IGL03334:A430078G23Rik APN 8 3388023 missense probably benign 0.04
R0417:A430078G23Rik UTSW 8 3388957 utr 3 prime probably benign
R0646:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R0759:A430078G23Rik UTSW 8 3388822 utr 3 prime probably benign
R0880:A430078G23Rik UTSW 8 3389032 utr 3 prime probably benign
R0980:A430078G23Rik UTSW 8 3389095 utr 3 prime probably benign
R1175:A430078G23Rik UTSW 8 3389023 utr 3 prime probably benign
R1649:A430078G23Rik UTSW 8 3389094 utr 3 prime probably benign
R1781:A430078G23Rik UTSW 8 3380495 missense probably damaging 0.98
R2211:A430078G23Rik UTSW 8 3387680 missense possibly damaging 0.95
R5319:A430078G23Rik UTSW 8 3385010 critical splice donor site probably null
R5415:A430078G23Rik UTSW 8 3388075 missense probably damaging 0.99
R5588:A430078G23Rik UTSW 8 3388878 utr 3 prime probably benign
R6455:A430078G23Rik UTSW 8 3388753 missense probably benign 0.16
R7573:A430078G23Rik UTSW 8 3384918 missense probably damaging 0.96
R7664:A430078G23Rik UTSW 8 3386390 missense probably damaging 0.98
R7731:A430078G23Rik UTSW 8 3384936 missense probably damaging 0.99
R7845:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R8167:A430078G23Rik UTSW 8 3353636 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGCATGCCTAGAAGCTTG -3'
(R):5'- GTGAAATAATGTCTCTCAAGCACC -3'

Sequencing Primer
(F):5'- AGGCATGCCTAGAAGCTTGTCTTC -3'
(R):5'- CAAAGTGTAGTTGCTACCAGC -3'
Posted On2014-12-04