Mutagenetix > Incidental Mutations

Incidental Mutation 'R2520:Gbf1'

254427

Institutional Source

Beutler Lab

Gene Symbol

Gbf1

Ensembl Gene

ENSMUSG00000025224

Gene Name

golgi-specific brefeldin A-resistance factor 1

Synonyms

1700083E03Rik

MMRRC Submission

040424-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2520 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46152509-46286510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46265367 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 571 (S571T)

Ref Sequence

ENSEMBL: ENSMUSP00000135062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]

Predicted Effect

probably benign
Transcript: ENSMUST00000026254
AA Change: S625T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: S625T

Domain	Start	End	E-Value	Type
low complexity region	270	288	N/A	INTRINSIC
Pfam:Sec7_N	400	551	3.4e-29	PFAM
Sec7	696	884	8.55e-91	SMART
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1773	1793	N/A	INTRINSIC
low complexity region	1802	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176422

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176853

Predicted Effect

probably benign
Transcript: ENSMUST00000176992
AA Change: S571T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: S571T

Domain	Start	End	E-Value	Type
low complexity region	216	234	N/A	INTRINSIC
Pfam:Sec7_N	343	498	1.5e-35	PFAM
Sec7	642	830	8.55e-91	SMART
low complexity region	1144	1162	N/A	INTRINSIC
low complexity region	1227	1242	N/A	INTRINSIC
low complexity region	1715	1735	N/A	INTRINSIC
low complexity region	1744	1762	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177406

Predicted Effect

probably benign
Transcript: ENSMUST00000177512

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	T	5: 3,575,773	N70I	probably damaging	Het
4930503B20Rik	G	A	3: 146,650,506	R216W	probably damaging	Het
Abcb9	C	T	5: 124,080,028		probably null	Het
Arhgdia	A	T	11: 120,580,026	V72E	probably damaging	Het
Arsb	A	T	13: 93,940,699	K525*	probably null	Het
Bckdha	A	C	7: 25,641,699	I79S	probably benign	Het
Carm1	G	A	9: 21,583,597		probably null	Het
Cers5	G	A	15: 99,736,381	T362I	probably damaging	Het
Clec4b2	T	A	6: 123,200,983	F86I	probably damaging	Het
Crispld1	G	A	1: 17,750,776	D347N	probably damaging	Het
Csf3r	A	T	4: 126,035,352	T352S	probably benign	Het
Daam2	G	A	17: 49,480,757	Q443*	probably null	Het
Dcbld1	A	G	10: 52,319,545	D283G	probably damaging	Het
Dpp9	T	C	17: 56,206,868	E82G	probably damaging	Het
Dync1li1	A	G	9: 114,689,006	D42G	probably null	Het
Eml6	T	C	11: 29,791,993	H1130R	probably damaging	Het
Enox1	A	T	14: 77,582,399	Y198F	probably damaging	Het
Epop	A	G	11: 97,628,728	L185P	probably benign	Het
Frem1	A	T	4: 82,950,290	C1485S	probably damaging	Het
Gm5965	A	T	16: 88,778,526	I196F	probably null	Het
Gm8237	T	A	14: 5,863,642	I8L	possibly damaging	Het
Gria2	A	C	3: 80,706,962	N590K	probably damaging	Het
Hectd2	T	A	19: 36,612,233		probably null	Het
Hmcn1	T	A	1: 150,743,647	T1239S	possibly damaging	Het
Hps3	A	T	3: 20,029,030	D167E	probably damaging	Het
Htr1a	A	G	13: 105,445,373	S374G	probably benign	Het
Il16	C	T	7: 83,651,994	G307S	probably benign	Het
Ipmk	T	C	10: 71,381,217	F198S	probably damaging	Het
Lyz2	T	A	10: 117,278,653	I124F	probably damaging	Het
Maea	T	C	5: 33,358,510	V47A	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mrgpra1	A	T	7: 47,335,272	C220S	possibly damaging	Het
Myo5c	A	T	9: 75,297,649	K1595*	probably null	Het
Naga	G	T	15: 82,330,094	D405E	probably benign	Het
Nanog	T	A	6: 122,713,459	N249K	probably benign	Het
Nhlh1	G	T	1: 172,054,003	R99S	probably damaging	Het
Ntrk2	T	A	13: 59,054,276		probably null	Het
Nudt2	A	G	4: 41,480,354	E79G	probably benign	Het
Olfr1313	A	T	2: 112,071,668	M305K	probably benign	Het
Olfr1368	A	T	13: 21,142,576	C160*	probably null	Het
Olfr666	T	A	7: 104,892,873	I252F	probably benign	Het
Pitpnm2	T	C	5: 124,129,401	D592G	probably damaging	Het
Prps1l3	T	C	12: 57,238,583	V53A	probably damaging	Het
Psmd2	T	G	16: 20,663,076	V853G	probably damaging	Het
Pycard	A	G	7: 127,993,505	I50T	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf168	T	A	16: 32,278,403	S99T	probably benign	Het
Rph3al	A	G	11: 75,906,547	S108P	possibly damaging	Het
Sdk1	G	A	5: 142,085,771	A979T	probably benign	Het
Sec16a	G	A	2: 26,441,356	Q216*	probably null	Het
Slc35f3	T	A	8: 126,394,573	V391E	possibly damaging	Het
Slf1	T	A	13: 77,051,265	I666F	probably damaging	Het
Slfn14	A	G	11: 83,276,187	V834A	probably damaging	Het
Tab2	G	A	10: 7,907,481	P679L	probably damaging	Het
Tbc1d10b	A	G	7: 127,200,283		probably null	Het
Tmeff1	T	A	4: 48,604,679	C91S	probably damaging	Het
Tmem108	G	T	9: 103,489,282	N503K	possibly damaging	Het
Trbv29	A	G	6: 41,271,607	T24A	probably damaging	Het
Trim34b	A	G	7: 104,331,239	E178G	probably damaging	Het
Trmt1l	T	A	1: 151,453,945	H546Q	probably benign	Het
Ttc39d	A	G	17: 80,216,370	I153V	probably benign	Het
Ttll13	T	C	7: 80,250,216	V101A	probably damaging	Het
Ubash3b	A	T	9: 41,014,947	H501Q	probably damaging	Het
Upf3a	T	A	8: 13,796,443		probably null	Het
Usp48	A	G	4: 137,625,251	S94G	probably benign	Het
Wdr86	T	C	5: 24,712,575	*381W	probably null	Het
Wdr90	G	A	17: 25,855,352	P680S	probably damaging	Het
Zbtb22	G	A	17: 33,916,982	V34M	probably damaging	Het
Zbtb8a	A	G	4: 129,359,896		probably null	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zfp512b	A	G	2: 181,589,502	V295A	probably damaging	Het
Zfp608	A	T	18: 54,988,506	V3E	possibly damaging	Het
Zfp748	G	T	13: 67,546,662	D32E	possibly damaging	Het

Other mutations in Gbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Gbf1	APN	19	46284249	critical splice acceptor site	probably null
IGL00988:Gbf1	APN	19	46284120	critical splice donor site	probably null
IGL01352:Gbf1	APN	19	46265215	missense	probably damaging	1.00
IGL01432:Gbf1	APN	19	46279995	missense	probably damaging	1.00
IGL01469:Gbf1	APN	19	46279364	missense	probably damaging	1.00
IGL01870:Gbf1	APN	19	46285669	missense	probably benign	0.00
IGL02019:Gbf1	APN	19	46279292	missense	possibly damaging	0.93
IGL02061:Gbf1	APN	19	46279258	missense	possibly damaging	0.65
IGL02126:Gbf1	APN	19	46252117	missense	probably damaging	0.97
IGL02272:Gbf1	APN	19	46269803	missense	probably damaging	1.00
IGL02346:Gbf1	APN	19	46285930	missense	probably damaging	1.00
IGL02491:Gbf1	APN	19	46262540	unclassified	probably benign
IGL03003:Gbf1	APN	19	46255655	missense	probably damaging	1.00
IGL03130:Gbf1	APN	19	46267348	missense	possibly damaging	0.82
IGL03376:Gbf1	APN	19	46262521	missense	possibly damaging	0.94
PIT4651001:Gbf1	UTSW	19	46163543	missense	probably benign
R0107:Gbf1	UTSW	19	46284828	missense	probably benign
R0139:Gbf1	UTSW	19	46261792	missense	probably damaging	1.00
R0180:Gbf1	UTSW	19	46285722	missense	probably benign
R0255:Gbf1	UTSW	19	46254110	splice site	probably benign
R0317:Gbf1	UTSW	19	46254020	missense	probably benign
R0329:Gbf1	UTSW	19	46272270	critical splice donor site	probably null
R0372:Gbf1	UTSW	19	46285704	missense	probably benign
R0666:Gbf1	UTSW	19	46262544	unclassified	probably benign
R1463:Gbf1	UTSW	19	46271545	unclassified	probably benign
R1701:Gbf1	UTSW	19	46261675	missense	probably damaging	1.00
R1848:Gbf1	UTSW	19	46272037	missense	possibly damaging	0.90
R1962:Gbf1	UTSW	19	46267219	missense	probably damaging	1.00
R1965:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R1966:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R2177:Gbf1	UTSW	19	46265670	missense	probably benign
R2238:Gbf1	UTSW	19	46163618	missense	probably benign
R2239:Gbf1	UTSW	19	46163618	missense	probably benign
R3821:Gbf1	UTSW	19	46264807	missense	probably damaging	0.99
R4681:Gbf1	UTSW	19	46280550	missense	probably benign	0.41
R4695:Gbf1	UTSW	19	46259167	nonsense	probably null
R4785:Gbf1	UTSW	19	46268395	missense	possibly damaging	0.89
R5202:Gbf1	UTSW	19	46268454	missense	probably benign	0.13
R5359:Gbf1	UTSW	19	46283725	critical splice donor site	probably null
R5468:Gbf1	UTSW	19	46284296	missense	possibly damaging	0.92
R5593:Gbf1	UTSW	19	46272524	missense	possibly damaging	0.91
R5595:Gbf1	UTSW	19	46284422	missense	possibly damaging	0.74
R5796:Gbf1	UTSW	19	46284343	missense	probably benign	0.08
R5938:Gbf1	UTSW	19	46268452	missense	probably damaging	1.00
R5957:Gbf1	UTSW	19	46246221	critical splice donor site	probably null
R6059:Gbf1	UTSW	19	46265248	missense	probably damaging	1.00
R6120:Gbf1	UTSW	19	46279321	missense	possibly damaging	0.83
R6239:Gbf1	UTSW	19	46259696	missense	probably benign	0.00
R6252:Gbf1	UTSW	19	46271556	missense	probably benign	0.33
R6310:Gbf1	UTSW	19	46280005	missense	probably damaging	0.96
R6787:Gbf1	UTSW	19	46271772	missense	probably benign
R6805:Gbf1	UTSW	19	46262507	missense	probably damaging	1.00
R6855:Gbf1	UTSW	19	46279941	missense	probably benign	0.00
R7313:Gbf1	UTSW	19	46280354	missense	possibly damaging	0.94
R7414:Gbf1	UTSW	19	46283358	nonsense	probably null
R7646:Gbf1	UTSW	19	46283672	missense	probably damaging	1.00
R7650:Gbf1	UTSW	19	46272539	missense	probably damaging	1.00
R7789:Gbf1	UTSW	19	46254002	missense	probably damaging	1.00
R7801:Gbf1	UTSW	19	46272643	missense	probably benign	0.03
Z1177:Gbf1	UTSW	19	46259142	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACCTCAAGTCTAATGGCTCTG -3'
(R):5'- TTATGGGCAGGAAGTCAAGC -3'

Sequencing Primer
(F):5'- CAGAATGCCTTTCCTGTGTCTGG -3'
(R):5'- CAGGAAGTCAAGCAGTATTGTC -3'

Posted On

2014-12-04