Mutagenetix > Incidental Mutations

Incidental Mutation 'R0317:Tlr1'

25443

Institutional Source

Beutler Lab

Gene Symbol

Tlr1

Ensembl Gene

ENSMUSG00000044827

Gene Name

toll-like receptor 1

Synonyms

MMRRC Submission

038527-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0317 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64924679-64933563 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 64925967 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 422 (C422*)

Ref Sequence

ENSEMBL: ENSMUSP00000142500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]

Predicted Effect

probably null
Transcript: ENSMUST00000059349
AA Change: C422*

SMART Domains

Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: C422*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LRR	71	94	5.72e0	SMART
LRR	116	140	3.27e2	SMART
low complexity region	240	256	N/A	INTRINSIC
LRR	374	397	9.75e0	SMART
LRR	400	423	4.98e1	SMART
low complexity region	427	438	N/A	INTRINSIC
LRR	448	469	6.23e1	SMART
LRR	470	494	4.57e0	SMART
LRRCT	527	581	2.5e-11	SMART
transmembrane domain	583	605	N/A	INTRINSIC
TIR	639	782	4.03e-41	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000197315
AA Change: C422*

SMART Domains

Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: C422*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LRR	71	94	5.72e0	SMART
Pfam:LRR_1	97	114	2.3e-2	PFAM
LRR	116	140	3.27e2	SMART
low complexity region	240	256	N/A	INTRINSIC
LRR	374	397	9.75e0	SMART
LRR	400	423	4.98e1	SMART
low complexity region	427	438	N/A	INTRINSIC
LRR	448	469	6.23e1	SMART
LRR	470	494	4.57e0	SMART
LRRCT	527	581	2.5e-11	SMART
transmembrane domain	583	605	N/A	INTRINSIC
TIR	639	782	4.03e-41	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,293,459	V1774A	probably damaging	Het
Adam34	G	A	8: 43,652,251	P119L	probably benign	Het
Ap3b2	T	C	7: 81,463,681		probably null	Het
Arfip2	G	A	7: 105,637,223	T124M	probably damaging	Het
Arhgef26	T	C	3: 62,423,544	S560P	probably damaging	Het
Bcl11a	A	T	11: 24,172,697		probably null	Het
Cab39	A	G	1: 85,849,160	E322G	probably damaging	Het
Cad	C	A	5: 31,072,321	P1382Q	probably benign	Het
Cc2d2a	T	C	5: 43,706,901		probably null	Het
Cela2a	A	T	4: 141,821,700		probably null	Het
Ces1e	A	C	8: 93,224,039	I38S	probably benign	Het
Ces1f	A	T	8: 93,263,391	F364I	probably benign	Het
Chgb	A	G	2: 132,793,811	T558A	probably benign	Het
Cnpy4	C	T	5: 138,192,812	Q217*	probably null	Het
Col4a3bp	C	T	13: 96,634,121	R487*	probably null	Het
Crlf1	A	G	8: 70,498,599	T43A	probably benign	Het
Dnah7b	T	A	1: 46,134,656	M707K	probably damaging	Het
Ets2	G	A	16: 95,712,149	S123N	probably damaging	Het
Fam196b	C	A	11: 34,402,826	D289E	possibly damaging	Het
Fry	T	C	5: 150,471,468	F304S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,116	R120H	probably benign	Het
Gbf1	A	G	19: 46,254,020	T96A	probably benign	Het
Ggn	T	A	7: 29,171,090	M1K	probably null	Het
Gm5239	A	G	18: 35,536,916	T112A	probably benign	Het
Kif1bp	A	T	10: 62,578,082		probably null	Het
Lrrc15	A	T	16: 30,273,743	H259Q	probably benign	Het
Lysmd4	A	G	7: 67,226,297	Y236C	probably damaging	Het
Med29	T	C	7: 28,386,859	T175A	possibly damaging	Het
Mfsd12	G	T	10: 81,357,799	D68Y	probably damaging	Het
Myh1	T	C	11: 67,217,512	L1308P	probably damaging	Het
Nphp4	T	A	4: 152,551,931		probably null	Het
Olfr948	A	G	9: 39,319,461	I51T	probably benign	Het
Pdhx	A	G	2: 103,028,280	V393A	probably benign	Het
Pgm5	A	G	19: 24,824,399	I155T	possibly damaging	Het
Pgr	A	T	9: 8,965,022	I889F	probably benign	Het
Phactr4	T	A	4: 132,386,930	K51I	probably damaging	Het
Pum2	T	A	12: 8,728,754	I468K	possibly damaging	Het
Rab11a	A	G	9: 64,725,553	S24P	probably damaging	Het
Rasef	T	C	4: 73,748,562	Q160R	probably damaging	Het
Rbl2	A	G	8: 91,087,144	D339G	probably benign	Het
Recql5	A	G	11: 115,894,673	S666P	probably benign	Het
Rfc1	A	T	5: 65,296,052		probably null	Het
Scarb1	A	G	5: 125,289,692	V59A	probably damaging	Het
Slc2a4	C	T	11: 69,946,356	V85M	probably damaging	Het
Slc6a12	A	G	6: 121,358,625	I291V	possibly damaging	Het
Slco3a1	A	C	7: 74,504,426	Y104D	probably damaging	Het
Suz12	T	A	11: 79,999,078	D13E	probably damaging	Het
Tmco1	T	C	1: 167,325,893	V114A	probably damaging	Het
Trpa1	T	C	1: 14,881,632	T948A	probably benign	Het
Tub	A	T	7: 109,020,927	N93Y	probably damaging	Het
Ufsp2	G	A	8: 45,992,233		probably null	Het
Veph1	T	C	3: 66,171,975	D373G	probably benign	Het
Vmn1r206	A	G	13: 22,620,960	S26P	possibly damaging	Het
Vmn2r1	T	C	3: 64,081,819	S60P	possibly damaging	Het
Wdcp	A	G	12: 4,851,583	S480G	probably benign	Het
Wnk4	T	C	11: 101,268,804	S612P	probably benign	Het
Zfp503	T	C	14: 21,986,459	K130E	probably benign	Het
Zkscan16	G	A	4: 58,957,602	C628Y	possibly damaging	Het

Other mutations in Tlr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Tlr1	APN	5	64926434	missense	probably benign	0.01
IGL01324:Tlr1	APN	5	64925179	missense	probably damaging	1.00
IGL01564:Tlr1	APN	5	64925846	missense	probably damaging	1.00
IGL01663:Tlr1	APN	5	64925073	missense	possibly damaging	0.48
IGL01689:Tlr1	APN	5	64925779	missense	probably damaging	0.97
IGL01749:Tlr1	APN	5	64925947	nonsense	probably null
IGL01751:Tlr1	APN	5	64925947	nonsense	probably null
IGL01769:Tlr1	APN	5	64925947	nonsense	probably null
IGL01899:Tlr1	APN	5	64927016	missense	probably damaging	0.97
IGL02197:Tlr1	APN	5	64926454	missense	probably damaging	1.00
IGL02295:Tlr1	APN	5	64925947	nonsense	probably null
IGL02308:Tlr1	APN	5	64925947	nonsense	probably null
IGL02309:Tlr1	APN	5	64925947	nonsense	probably null
IGL02311:Tlr1	APN	5	64925947	nonsense	probably null
IGL02591:Tlr1	APN	5	64926716	missense	probably damaging	1.00
IGL02739:Tlr1	APN	5	64927126	missense	probably benign	0.41
IGL03206:Tlr1	APN	5	64925057	missense	probably damaging	0.99
IGL03055:Tlr1	UTSW	5	64926596	missense	probably benign	0.05
R0315:Tlr1	UTSW	5	64926928	missense	probably damaging	0.99
R0511:Tlr1	UTSW	5	64926620	missense	probably damaging	0.98
R1539:Tlr1	UTSW	5	64926976	missense	probably damaging	1.00
R1552:Tlr1	UTSW	5	64926860	missense	probably damaging	1.00
R1835:Tlr1	UTSW	5	64925700	missense	probably benign	0.01
R1933:Tlr1	UTSW	5	64925438	missense	possibly damaging	0.94
R1956:Tlr1	UTSW	5	64925177	missense	probably damaging	1.00
R2099:Tlr1	UTSW	5	64925068	missense	probably damaging	1.00
R2507:Tlr1	UTSW	5	64925296	missense	probably damaging	1.00
R2508:Tlr1	UTSW	5	64925296	missense	probably damaging	1.00
R2937:Tlr1	UTSW	5	64925908	missense	probably damaging	0.96
R2938:Tlr1	UTSW	5	64925908	missense	probably damaging	0.96
R3033:Tlr1	UTSW	5	64925569	missense	probably damaging	1.00
R4164:Tlr1	UTSW	5	64927202	missense	possibly damaging	0.47
R4226:Tlr1	UTSW	5	64925717	missense	probably damaging	0.96
R4366:Tlr1	UTSW	5	64925837	missense	probably benign	0.00
R5009:Tlr1	UTSW	5	64926224	missense	probably damaging	1.00
R5029:Tlr1	UTSW	5	64925681	missense	probably damaging	0.97
R5069:Tlr1	UTSW	5	64926400	missense	probably benign	0.01
R5186:Tlr1	UTSW	5	64925221	missense	probably damaging	1.00
R5336:Tlr1	UTSW	5	64925802	missense	probably damaging	1.00
R5500:Tlr1	UTSW	5	64927098	missense	probably benign	0.08
R5503:Tlr1	UTSW	5	64926292	missense	probably damaging	0.99
R5577:Tlr1	UTSW	5	64926085	missense	possibly damaging	0.94
R6141:Tlr1	UTSW	5	64925213	missense	possibly damaging	0.92
R6210:Tlr1	UTSW	5	64925286	missense	probably damaging	1.00
R6238:Tlr1	UTSW	5	64927129	missense	possibly damaging	0.86
R6284:Tlr1	UTSW	5	64927099	missense	possibly damaging	0.93
R6311:Tlr1	UTSW	5	64926845	missense	probably damaging	0.99
R7021:Tlr1	UTSW	5	64925713	missense	possibly damaging	0.75
R7140:Tlr1	UTSW	5	64925678	missense	probably benign	0.01
R7234:Tlr1	UTSW	5	64926724	missense	probably damaging	0.96
R7278:Tlr1	UTSW	5	64926772	missense	probably benign	0.03
R7378:Tlr1	UTSW	5	64925228	missense	not run
R7652:Tlr1	UTSW	5	64926787	nonsense	probably null
X0067:Tlr1	UTSW	5	64926575	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTACATTGAGTTCCTGCAAAGCC -3'
(R):5'- GGAACACACATGGTCCACATGCTG -3'

Sequencing Primer
(F):5'- GTGAAGGTCAAGGACCTTGA -3'
(R):5'- GCATGTGGACTTTACAGATAACC -3'

Posted On

2013-04-16