Incidental Mutation 'R2566:Fastkd5'
ID254441
Institutional Source Beutler Lab
Gene Symbol Fastkd5
Ensembl Gene ENSMUSG00000079043
Gene NameFAST kinase domains 5
Synonyms
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130613840-130630027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130616365 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 102 (K102E)
Ref Sequence ENSEMBL: ENSMUSP00000137385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028761] [ENSMUST00000110262] [ENSMUST00000140581] [ENSMUST00000179273]
Predicted Effect probably benign
Transcript: ENSMUST00000028761
SMART Domains Protein: ENSMUSP00000028761
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Ubox 262 331 4.47e-15 SMART
low complexity region 371 395 N/A INTRINSIC
RING 481 525 3.14e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110262
AA Change: K102E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105891
Gene: ENSMUSG00000079043
AA Change: K102E

DomainStartEndE-ValueType
Pfam:FAST_1 475 544 6e-22 PFAM
Pfam:FAST_2 555 646 7.2e-25 PFAM
RAP 742 801 6.92e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140581
AA Change: K102E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114878
Gene: ENSMUSG00000027300
AA Change: K102E

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 2.6e-27 PFAM
Pfam:FAST_2 553 598 2.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179273
AA Change: K102E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000137385
Gene: ENSMUSG00000079043
AA Change: K102E

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 1.5e-26 PFAM
Pfam:FAST_2 553 646 4.4e-29 PFAM
RAP 742 801 6.92e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Fastkd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Fastkd5 APN 2 130616377 missense probably benign 0.14
IGL01148:Fastkd5 APN 2 130614685 missense probably benign
IGL01765:Fastkd5 APN 2 130615734 missense possibly damaging 0.95
IGL01806:Fastkd5 APN 2 130615612 missense probably benign 0.02
IGL02266:Fastkd5 APN 2 130615561 missense probably damaging 1.00
IGL02879:Fastkd5 APN 2 130614421 missense probably damaging 0.97
R0504:Fastkd5 UTSW 2 130615917 missense probably benign 0.08
R0544:Fastkd5 UTSW 2 130615296 missense probably damaging 1.00
R1140:Fastkd5 UTSW 2 130616215 missense probably benign 0.00
R1459:Fastkd5 UTSW 2 130614797 missense probably damaging 0.97
R1770:Fastkd5 UTSW 2 130614280 missense probably damaging 1.00
R2519:Fastkd5 UTSW 2 130616194 missense possibly damaging 0.56
R3080:Fastkd5 UTSW 2 130615453 missense possibly damaging 0.89
R4496:Fastkd5 UTSW 2 130616581 missense probably benign 0.01
R5566:Fastkd5 UTSW 2 130614301 missense possibly damaging 0.88
R6516:Fastkd5 UTSW 2 130614301 missense possibly damaging 0.88
R6993:Fastkd5 UTSW 2 130616539 missense probably benign
R7032:Fastkd5 UTSW 2 130615944 missense possibly damaging 0.92
R7049:Fastkd5 UTSW 2 130615511 missense probably damaging 1.00
R7051:Fastkd5 UTSW 2 130614417 missense probably damaging 1.00
R7331:Fastkd5 UTSW 2 130615727 missense possibly damaging 0.79
R7348:Fastkd5 UTSW 2 130615135 missense probably damaging 1.00
R7348:Fastkd5 UTSW 2 130616439 missense probably benign 0.00
R7524:Fastkd5 UTSW 2 130616128 missense probably benign 0.41
R7603:Fastkd5 UTSW 2 130615041 missense possibly damaging 0.95
R7657:Fastkd5 UTSW 2 130616256 missense probably benign 0.00
R7745:Fastkd5 UTSW 2 130615068 missense probably damaging 1.00
X0018:Fastkd5 UTSW 2 130616612 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TAGCTGTGAAGCTGGTACTCTG -3'
(R):5'- GCACAGACTCCAGAATGTCAG -3'

Sequencing Primer
(F):5'- AGAAAACTCGGGTTCCTTCG -3'
(R):5'- GAATGTCAGCCGCTCTCAAG -3'
Posted On2014-12-04