Mutagenetix > Incidental Mutations

Incidental Mutation 'R2566:Brca2'

254459

Institutional Source

Beutler Lab

Gene Symbol

Brca2

Ensembl Gene

ENSMUSG00000041147

Gene Name

breast cancer 2, early onset

Synonyms

Fancd1, RAB163

MMRRC Submission

040425-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2566 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

150522630-150570329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 150541762 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1664 (T1664S)

Ref Sequence

ENSEMBL: ENSMUSP00000144150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044620
AA Change: T1664S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: T1664S

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202003

SMART Domains

Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202313
AA Change: T1664S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: T1664S

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202975

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,293,071	K408E	probably damaging	Het
2010315B03Rik	T	A	9: 124,293,153	K380N	probably damaging	Het
9230104M06Rik	C	T	12: 113,000,739		probably benign	Het
Ahi1	T	A	10: 20,970,911	C413*	probably null	Het
Alms1	T	A	6: 85,622,482	M1430K	possibly damaging	Het
Ankrd52	G	T	10: 128,389,351	A894S	probably benign	Het
Arhgap33	C	A	7: 30,527,229	V494L	probably damaging	Het
Atic	G	T	1: 71,568,971	V275F	probably damaging	Het
Atoh1	T	A	6: 64,729,684	V121E	probably damaging	Het
Atp5h	T	A	11: 115,416,038		probably null	Het
Baiap2l2	A	T	15: 79,261,974		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Celf3	ACAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCA	3: 94,488,230		probably benign	Het
Cep350	A	T	1: 155,959,718		probably null	Het
Ces2g	T	C	8: 104,965,989		probably null	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyp2d34	A	G	15: 82,616,167	F457S	probably damaging	Het
Disp3	T	A	4: 148,241,423	T1293S	probably damaging	Het
Dock10	T	A	1: 80,540,253	I1348F	possibly damaging	Het
Dsp	A	T	13: 38,196,404	H1776L	probably damaging	Het
Efhd1	A	T	1: 87,309,755	Q228L	possibly damaging	Het
Entpd2	T	A	2: 25,399,283	I259N	probably benign	Het
Fam149b	A	T	14: 20,375,510	M138L	probably damaging	Het
Fastkd5	T	C	2: 130,616,365	K102E	probably benign	Het
Fzd7	C	A	1: 59,484,536	T526K	possibly damaging	Het
G6pd2	T	A	5: 61,808,987	I35N	probably damaging	Het
Gars	T	A	6: 55,065,563	M427K	probably damaging	Het
Gimap4	C	T	6: 48,690,865	R57C	probably damaging	Het
Gm11232	C	A	4: 71,757,785	W41L	probably benign	Het
Gm15737	T	A	6: 92,879,720	C43*	probably null	Het
Gm853	A	T	4: 130,209,888	L420Q	probably benign	Het
Gpr180	T	C	14: 118,139,773	V62A	probably benign	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Jakmip3	A	T	7: 138,989,468	E27V	possibly damaging	Het
Kcnq3	T	C	15: 66,031,427	T145A	probably damaging	Het
Krt8	A	G	15: 101,998,024	M350T	probably benign	Het
Krtap4-9	T	A	11: 99,785,666		probably benign	Het
Lbr	G	T	1: 181,836,127	D109E	probably damaging	Het
Med23	A	G	10: 24,888,575	H42R	probably damaging	Het
Mgat5	A	T	1: 127,307,004	M77L	probably benign	Het
Mlf1	A	T	3: 67,384,586	N28I	possibly damaging	Het
Mroh3	A	C	1: 136,198,126	L343R	probably damaging	Het
Mrpl37	T	A	4: 107,064,493	I180F	possibly damaging	Het
Mrps27	T	A	13: 99,400,328	C116*	probably null	Het
Muc6	A	G	7: 141,640,384	S1354P	possibly damaging	Het
Myh7	A	T	14: 54,983,242	D1033E	probably damaging	Het
Myo16	A	T	8: 10,594,820	E1717D	probably benign	Het
Myo1g	T	A	11: 6,512,539		probably null	Het
Olfr610	A	G	7: 103,506,160	M262T	probably benign	Het
Olfr815	A	C	10: 129,902,095	L205R	probably damaging	Het
Pan2	T	C	10: 128,313,897	L576P	probably damaging	Het
Parp8	A	G	13: 116,895,687	S278P	possibly damaging	Het
Pdk2	A	G	11: 95,027,202		probably null	Het
Phf1	T	C	17: 26,937,088	S450P	probably damaging	Het
Pkd1l2	T	C	8: 117,019,494	Y1919C	probably damaging	Het
Postn	T	A	3: 54,376,953	S614T	probably damaging	Het
Psmg1	A	T	16: 95,982,195	Y213*	probably null	Het
Rab11b	T	A	17: 33,747,718	T203S	probably benign	Het
Rad54l2	T	A	9: 106,703,626	T899S	possibly damaging	Het
Ramp2	TTGCTGCTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTG	11: 101,246,545		probably benign	Het
Rapgef6	A	G	11: 54,687,711	T1028A	possibly damaging	Het
Rbm6	A	G	9: 107,791,998	S58P	possibly damaging	Het
Rreb1	G	T	13: 37,929,792	A376S	possibly damaging	Het
Rsbn1l	T	A	5: 20,919,769	N345I	probably benign	Het
Sf3b2	A	T	19: 5,275,090	S785T	possibly damaging	Het
Sh2b1	C	T	7: 126,468,926	D519N	probably damaging	Het
Slitrk6	T	C	14: 110,750,272	T668A	probably benign	Het
Stkld1	T	A	2: 26,950,638	I444N	probably damaging	Het
Sucla2	A	T	14: 73,552,804		probably benign	Het
Tmem67	T	A	4: 12,079,918	L190F	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trem2	G	A	17: 48,351,835	W191*	probably null	Het
Ube2d4	A	T	15: 58,846,679		noncoding transcript	Het
Uimc1	G	T	13: 55,075,804	D218E	probably damaging	Het
Wdr62	A	T	7: 30,273,999	V95E	probably damaging	Het
Zfhx4	T	C	3: 5,245,143	V862A	probably damaging	Het
Zfp462	T	A	4: 55,008,522	S163T	probably benign	Het
Zfp704	T	C	3: 9,609,493	D76G	unknown	Het

Other mutations in Brca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Brca2	APN	5	150539898	missense	probably benign	0.18
IGL00392:Brca2	APN	5	150541240	missense	probably benign	0.02
IGL00557:Brca2	APN	5	150560538	missense	probably benign
IGL00798:Brca2	APN	5	150539463	missense	probably benign	0.30
IGL00933:Brca2	APN	5	150542404	missense	probably benign	0.04
IGL00964:Brca2	APN	5	150532310	missense	probably damaging	1.00
IGL01152:Brca2	APN	5	150542390	missense	probably damaging	0.99
IGL01577:Brca2	APN	5	150541620	nonsense	probably null
IGL01585:Brca2	APN	5	150539516	missense	possibly damaging	0.76
IGL01732:Brca2	APN	5	150542387	missense	probably benign	0.13
IGL01809:Brca2	APN	5	150531061	splice site	probably null
IGL01911:Brca2	APN	5	150567613	missense	probably damaging	0.96
IGL02113:Brca2	APN	5	150540979	missense	possibly damaging	0.95
IGL02313:Brca2	APN	5	150538661	missense	probably damaging	1.00
IGL02342:Brca2	APN	5	150542824	missense	possibly damaging	0.94
IGL02508:Brca2	APN	5	150543308	missense	possibly damaging	0.85
IGL02532:Brca2	APN	5	150550862	missense	probably damaging	1.00
IGL02646:Brca2	APN	5	150560790	missense	possibly damaging	0.89
IGL02738:Brca2	APN	5	150567035	missense	probably damaging	1.00
IGL02833:Brca2	APN	5	150541790	missense	possibly damaging	0.83
IGL02871:Brca2	APN	5	150542552	missense	probably benign	0.13
IGL02995:Brca2	APN	5	150529488	missense	probably damaging	1.00
IGL03105:Brca2	APN	5	150560485	missense	probably benign	0.02
BB007:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
BB017:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R0219:Brca2	UTSW	5	150523175	splice site	probably benign
R0416:Brca2	UTSW	5	150569392	missense	possibly damaging	0.93
R0441:Brca2	UTSW	5	150541857	missense	probably damaging	0.96
R0548:Brca2	UTSW	5	150544935	missense	probably damaging	0.96
R0745:Brca2	UTSW	5	150544882	splice site	probably benign
R0799:Brca2	UTSW	5	150560193	missense	probably damaging	0.99
R1165:Brca2	UTSW	5	150542747	missense	probably damaging	0.98
R1247:Brca2	UTSW	5	150541274	missense	probably damaging	1.00
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1444:Brca2	UTSW	5	150542450	missense	probably benign
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1584:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1599:Brca2	UTSW	5	150548713	nonsense	probably null
R1600:Brca2	UTSW	5	150560830	splice site	probably benign
R1822:Brca2	UTSW	5	150540198	missense	probably benign	0.06
R1824:Brca2	UTSW	5	150536922	missense	possibly damaging	0.94
R2037:Brca2	UTSW	5	150540669	missense	probably benign
R2131:Brca2	UTSW	5	150557129	missense	probably damaging	1.00
R2203:Brca2	UTSW	5	150539502	missense	possibly damaging	0.58
R2208:Brca2	UTSW	5	150532344	missense	probably damaging	0.96
R2293:Brca2	UTSW	5	150560534	missense	possibly damaging	0.86
R2517:Brca2	UTSW	5	150539672	missense	probably benign	0.04
R3422:Brca2	UTSW	5	150543121	missense	possibly damaging	0.91
R3917:Brca2	UTSW	5	150540827	missense	probably damaging	0.96
R3946:Brca2	UTSW	5	150536704	missense	probably damaging	0.96
R4176:Brca2	UTSW	5	150539633	nonsense	probably null
R4255:Brca2	UTSW	5	150541169	missense	possibly damaging	0.92
R4450:Brca2	UTSW	5	150536053	missense	probably damaging	0.96
R4603:Brca2	UTSW	5	150536165	missense	possibly damaging	0.86
R4681:Brca2	UTSW	5	150552398	splice site	probably null
R4755:Brca2	UTSW	5	150559987	splice site	probably null
R4762:Brca2	UTSW	5	150531116	missense	probably benign	0.00
R4824:Brca2	UTSW	5	150539735	missense	probably damaging	1.00
R4887:Brca2	UTSW	5	150556937	missense	probably damaging	1.00
R5020:Brca2	UTSW	5	150560436	missense	probably damaging	1.00
R5159:Brca2	UTSW	5	150542108	missense	possibly damaging	0.93
R5216:Brca2	UTSW	5	150542980	missense	probably damaging	0.99
R5269:Brca2	UTSW	5	150539223	missense	possibly damaging	0.75
R5274:Brca2	UTSW	5	150539689	missense	probably benign	0.00
R5589:Brca2	UTSW	5	150557132	missense	possibly damaging	0.67
R5619:Brca2	UTSW	5	150557114	missense	probably damaging	0.96
R5641:Brca2	UTSW	5	150556899	missense	probably damaging	1.00
R5686:Brca2	UTSW	5	150540904	missense	probably benign	0.00
R5730:Brca2	UTSW	5	150569005	missense	possibly damaging	0.85
R5763:Brca2	UTSW	5	150548006	missense	possibly damaging	0.85
R5877:Brca2	UTSW	5	150543221	missense	possibly damaging	0.53
R5893:Brca2	UTSW	5	150569138	missense	probably benign	0.02
R5900:Brca2	UTSW	5	150541132	missense	probably benign	0.01
R5926:Brca2	UTSW	5	150534622	missense	probably benign	0.07
R5966:Brca2	UTSW	5	150543251	missense	probably damaging	0.99
R6025:Brca2	UTSW	5	150541575	frame shift	probably null
R6062:Brca2	UTSW	5	150556889	missense	probably damaging	0.96
R6141:Brca2	UTSW	5	150540637	missense	possibly damaging	0.91
R6244:Brca2	UTSW	5	150566978	missense	probably benign	0.08
R6508:Brca2	UTSW	5	150536593	missense	possibly damaging	0.91
R6519:Brca2	UTSW	5	150540979	missense	probably damaging	0.99
R6611:Brca2	UTSW	5	150536193	missense	probably damaging	0.99
R6698:Brca2	UTSW	5	150532394	missense	probably damaging	1.00
R6856:Brca2	UTSW	5	150540208	missense	possibly damaging	0.68
R6912:Brca2	UTSW	5	150541742	missense	probably damaging	0.99
R7002:Brca2	UTSW	5	150539918	missense	probably benign
R7025:Brca2	UTSW	5	150540478	missense	probably benign	0.39
R7151:Brca2	UTSW	5	150541436	missense	probably benign	0.12
R7202:Brca2	UTSW	5	150532354	missense	probably benign	0.03
R7365:Brca2	UTSW	5	150532337	missense	probably damaging	0.99
R7510:Brca2	UTSW	5	150536691	missense	possibly damaging	0.85
R7612:Brca2	UTSW	5	150540611	missense	probably benign	0.03
R7682:Brca2	UTSW	5	150543153	missense	probably benign
R7890:Brca2	UTSW	5	150539381	missense	possibly damaging	0.83
R7930:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R7940:Brca2	UTSW	5	150538733	missense	probably benign
R8054:Brca2	UTSW	5	150536504	missense	probably benign	0.02
R8056:Brca2	UTSW	5	150569306	missense	possibly damaging	0.85
R8080:Brca2	UTSW	5	150539892	missense	probably benign	0.11
R8094:Brca2	UTSW	5	150536169	missense	possibly damaging	0.85
R8306:Brca2	UTSW	5	150536663	missense	possibly damaging	0.91
R8401:Brca2	UTSW	5	150552352	missense	probably damaging	1.00
R8523:Brca2	UTSW	5	150560148	missense	possibly damaging	0.75
R8784:Brca2	UTSW	5	150548661	nonsense	probably null
R8791:Brca2	UTSW	5	150542596	missense	possibly damaging	0.92
R8832:Brca2	UTSW	5	150542146	missense	possibly damaging	0.91
R8838:Brca2	UTSW	5	150541540	missense	possibly damaging	0.91
R8845:Brca2	UTSW	5	150543382	missense	possibly damaging	0.85
R8898:Brca2	UTSW	5	150569033	missense	possibly damaging	0.53
R8914:Brca2	UTSW	5	150541743	missense	probably damaging	0.96
R8935:Brca2	UTSW	5	150568981	missense	possibly damaging	0.70
R9014:Brca2	UTSW	5	150541754	missense	probably benign
R9023:Brca2	UTSW	5	150541895	missense	probably benign	0.07
R9094:Brca2	UTSW	5	150552305	missense	probably benign	0.08
R9195:Brca2	UTSW	5	150539953	missense	possibly damaging	0.83
R9198:Brca2	UTSW	5	150536512	missense	possibly damaging	0.91
R9314:Brca2	UTSW	5	150550894	missense	probably damaging	0.96
R9408:Brca2	UTSW	5	150541517	missense	probably damaging	1.00
Z1088:Brca2	UTSW	5	150542763	missense	probably damaging	0.96
Z1186:Brca2	UTSW	5	150536583	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGTACCTCTTCCAAAGTACAAG -3'
(R):5'- CCTGAATCATTATGCATGTCATCAC -3'

Sequencing Primer
(F):5'- GTACCTCTTCCAAAGTACAAGAAAAC -3'
(R):5'- TCACAATGACAAAAACTAGACTGGG -3'

Posted On

2014-12-04