Incidental Mutation 'R2566:Olfr610'
ID254468
Institutional Source Beutler Lab
Gene Symbol Olfr610
Ensembl Gene ENSMUSG00000045584
Gene Nameolfactory receptor 610
SynonymsMOR9-2, GA_x6K02T2PBJ9-6221839-6220892
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103505375-103512122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103506160 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 262 (M262T)
Ref Sequence ENSEMBL: ENSMUSP00000150921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063109] [ENSMUST00000217627]
Predicted Effect probably benign
Transcript: ENSMUST00000063109
AA Change: M262T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000052577
Gene: ENSMUSG00000045584
AA Change: M262T

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 3.5e-106 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.9e-10 PFAM
Pfam:7tm_1 43 295 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213422
Predicted Effect probably benign
Transcript: ENSMUST00000217627
AA Change: M262T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Olfr610
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Olfr610 APN 7 103506796 missense possibly damaging 0.67
IGL02179:Olfr610 APN 7 103506727 missense probably damaging 1.00
IGL02303:Olfr610 APN 7 103506088 missense probably benign 0.05
IGL02507:Olfr610 APN 7 103506718 nonsense probably null
IGL02562:Olfr610 APN 7 103506216 nonsense probably null
IGL02806:Olfr610 APN 7 103506003 missense probably benign 0.10
R0743:Olfr610 UTSW 7 103506862 nonsense probably null
R0884:Olfr610 UTSW 7 103506862 nonsense probably null
R1673:Olfr610 UTSW 7 103506689 missense probably damaging 0.99
R1752:Olfr610 UTSW 7 103506558 missense probably benign 0.02
R1800:Olfr610 UTSW 7 103506041 missense possibly damaging 0.89
R2043:Olfr610 UTSW 7 103506943 start codon destroyed probably null 0.98
R2254:Olfr610 UTSW 7 103506064 missense probably damaging 1.00
R4433:Olfr610 UTSW 7 103506139 missense probably benign 0.04
R5206:Olfr610 UTSW 7 103506102 nonsense probably null
R5470:Olfr610 UTSW 7 103506509 missense probably benign 0.00
R6020:Olfr610 UTSW 7 103506799 missense probably benign
R6848:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
R7222:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
R7832:Olfr610 UTSW 7 103506379 missense probably damaging 1.00
R7837:Olfr610 UTSW 7 103506845 missense possibly damaging 0.80
R7893:Olfr610 UTSW 7 103506610 missense possibly damaging 0.86
R7915:Olfr610 UTSW 7 103506379 missense probably damaging 1.00
R7920:Olfr610 UTSW 7 103506845 missense possibly damaging 0.80
R7976:Olfr610 UTSW 7 103506610 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAGTCTGTACCTAGGACTGAGG -3'
(R):5'- TCAACAGTGGCTTTGGGCTC -3'

Sequencing Primer
(F):5'- CTGTACCTAGGACTGAGGAATTGTC -3'
(R):5'- CTTTGTCATGCTCTCTACATTGGGG -3'
Posted On2014-12-04