Incidental Mutation 'R2566:Sh2b1'
ID254469
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene NameSH2B adaptor protein 1
SynonymsIrip, SH2-Bb, SH2-B, Sh2bpsm1
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126466994-126475424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126468926 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 519 (D519N)
Ref Sequence ENSEMBL: ENSMUSP00000146282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206643] [ENSMUST00000206664]
Predicted Effect probably damaging
Transcript: ENSMUST00000032978
AA Change: D519N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733
AA Change: D519N

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205340
AA Change: D519N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000205440
AA Change: D519N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000205497
AA Change: D519N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000205733
AA Change: D519N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000205889
AA Change: D519N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206515
Predicted Effect probably benign
Transcript: ENSMUST00000206643
Predicted Effect probably benign
Transcript: ENSMUST00000206664
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126469293 missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126469169 missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126469268 missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126472474 missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126468530 missense possibly damaging 0.61
R0130:Sh2b1 UTSW 7 126471448 missense possibly damaging 0.95
R0532:Sh2b1 UTSW 7 126472272 missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126472690 missense possibly damaging 0.62
R2109:Sh2b1 UTSW 7 126472364 missense possibly damaging 0.74
R2409:Sh2b1 UTSW 7 126471479 missense probably damaging 1.00
R3752:Sh2b1 UTSW 7 126468787 missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126471446 missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126468803 missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126471236 missense probably benign
R5912:Sh2b1 UTSW 7 126471470 missense probably damaging 1.00
R7368:Sh2b1 UTSW 7 126468513 missense possibly damaging 0.59
R7694:Sh2b1 UTSW 7 126467757 missense probably benign 0.03
R7801:Sh2b1 UTSW 7 126471292 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATCCCCAGATTCTCCTTCAGGG -3'
(R):5'- CCACAGGTATTGGGTGCATG -3'

Sequencing Primer
(F):5'- TTCAGGGCCACTCACCTTGG -3'
(R):5'- ACAGGTATTGGGTGCATGTGTATTTG -3'
Posted On2014-12-04