Incidental Mutation 'R0317:Slc6a12'
ID25448
Institutional Source Beutler Lab
Gene Symbol Slc6a12
Ensembl Gene ENSMUSG00000030109
Gene Namesolute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
SynonymsBGT1, Gabt2
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location121343076-121365775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121358625 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 291 (I291V)
Ref Sequence ENSEMBL: ENSMUSP00000126708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032200] [ENSMUST00000163771] [ENSMUST00000165456] [ENSMUST00000166390] [ENSMUST00000166457] [ENSMUST00000171008]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032200
AA Change: I305V

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032200
Gene: ENSMUSG00000030109
AA Change: I305V

DomainStartEndE-ValueType
Pfam:SNF 50 575 2e-242 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163771
AA Change: I54V

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127779
Gene: ENSMUSG00000030109
AA Change: I54V

DomainStartEndE-ValueType
Pfam:SNF 1 128 3.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165456
SMART Domains Protein: ENSMUSP00000130715
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
Pfam:SNF 1 49 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166390
SMART Domains Protein: ENSMUSP00000128217
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
low complexity region 35 52 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166457
AA Change: I291V

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126937
Gene: ENSMUSG00000030109
AA Change: I291V

DomainStartEndE-ValueType
Pfam:SNF 36 561 2.5e-242 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170582
Predicted Effect possibly damaging
Transcript: ENSMUST00000171008
AA Change: I291V

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109
AA Change: I291V

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171874
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal seizure threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Slc6a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Slc6a12 APN 6 121360455 missense probably damaging 1.00
IGL02066:Slc6a12 APN 6 121352056 missense probably damaging 0.97
IGL02146:Slc6a12 APN 6 121353501 missense probably benign 0.01
IGL02475:Slc6a12 APN 6 121354375 splice site probably null
IGL02498:Slc6a12 APN 6 121361070 missense probably benign
IGL02537:Slc6a12 APN 6 121360514 missense probably benign 0.00
IGL02696:Slc6a12 APN 6 121363252 missense probably benign 0.00
IGL03255:Slc6a12 APN 6 121354287 missense probably damaging 0.99
IGL03397:Slc6a12 APN 6 121357045 missense probably damaging 1.00
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0201:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0255:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0302:Slc6a12 UTSW 6 121363259 missense probably damaging 1.00
R0394:Slc6a12 UTSW 6 121346998 critical splice donor site probably null
R0492:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0532:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0550:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0551:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R1421:Slc6a12 UTSW 6 121359126 missense probably damaging 1.00
R1487:Slc6a12 UTSW 6 121363757 nonsense probably null
R1879:Slc6a12 UTSW 6 121347423 missense probably damaging 1.00
R1905:Slc6a12 UTSW 6 121347443 nonsense probably null
R1925:Slc6a12 UTSW 6 121360526 missense probably benign 0.44
R3944:Slc6a12 UTSW 6 121354280 critical splice acceptor site probably null
R4515:Slc6a12 UTSW 6 121353530 critical splice donor site probably null
R4559:Slc6a12 UTSW 6 121363861 splice site probably null
R4628:Slc6a12 UTSW 6 121351992 nonsense probably null
R4665:Slc6a12 UTSW 6 121359013 splice site probably benign
R4753:Slc6a12 UTSW 6 121356903 splice site probably benign
R4948:Slc6a12 UTSW 6 121355322 missense probably benign 0.35
R5517:Slc6a12 UTSW 6 121354339 missense probably benign 0.10
R6717:Slc6a12 UTSW 6 121354303 missense probably benign 0.01
R7139:Slc6a12 UTSW 6 121365319 missense probably benign
R7318:Slc6a12 UTSW 6 121352013 missense probably damaging 0.99
R7318:Slc6a12 UTSW 6 121352019 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGCCACCTGCGAATGAAATAGTCC -3'
(R):5'- GTGATATGGCACAGGCAACACAAAC -3'

Sequencing Primer
(F):5'- AAACAGGCCCTGCTTATGG -3'
(R):5'- AACACCAGATGTCAGGGC -3'
Posted On2013-04-16