Incidental Mutation 'R2566:Med23'
ID 254483
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms ESTM7, 3000002A17Rik, X83317, Sur2, Crsp3, sno
MMRRC Submission 040425-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2566 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 24745889-24789358 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24764473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 42 (H42R)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020159
AA Change: H354R

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: H354R

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: H360R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: H360R

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: H42R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: H42R

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176502
AA Change: H152R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984
AA Change: H152R

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,055,701 (GRCm39) K408E probably damaging Het
2010315B03Rik T A 9: 124,055,783 (GRCm39) K380N probably damaging Het
9230104M06Rik C T 12: 112,964,359 (GRCm39) probably benign Het
Ahi1 T A 10: 20,846,810 (GRCm39) C413* probably null Het
Alms1 T A 6: 85,599,464 (GRCm39) M1430K possibly damaging Het
Ankrd52 G T 10: 128,225,220 (GRCm39) A894S probably benign Het
Arhgap33 C A 7: 30,226,654 (GRCm39) V494L probably damaging Het
Atic G T 1: 71,608,130 (GRCm39) V275F probably damaging Het
Atoh1 T A 6: 64,706,668 (GRCm39) V121E probably damaging Het
Atp5pd T A 11: 115,306,864 (GRCm39) probably null Het
Baiap2l2 A T 15: 79,146,174 (GRCm39) probably null Het
Brca2 A T 5: 150,465,227 (GRCm39) T1664S probably benign Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,395,537 (GRCm39) probably benign Het
Cep350 A T 1: 155,835,464 (GRCm39) probably null Het
Ces2g T C 8: 105,692,621 (GRCm39) probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Cyp2d34 A G 15: 82,500,368 (GRCm39) F457S probably damaging Het
Disp3 T A 4: 148,325,880 (GRCm39) T1293S probably damaging Het
Dock10 T A 1: 80,517,970 (GRCm39) I1348F possibly damaging Het
Dsp A T 13: 38,380,380 (GRCm39) H1776L probably damaging Het
Efhd1 A T 1: 87,237,477 (GRCm39) Q228L possibly damaging Het
Entpd2 T A 2: 25,289,295 (GRCm39) I259N probably benign Het
Fam149b A T 14: 20,425,578 (GRCm39) M138L probably damaging Het
Fastkd5 T C 2: 130,458,285 (GRCm39) K102E probably benign Het
Fzd7 C A 1: 59,523,695 (GRCm39) T526K possibly damaging Het
G6pd2 T A 5: 61,966,330 (GRCm39) I35N probably damaging Het
Gars1 T A 6: 55,042,548 (GRCm39) M427K probably damaging Het
Gimap4 C T 6: 48,667,799 (GRCm39) R57C probably damaging Het
Gm11232 C A 4: 71,676,022 (GRCm39) W41L probably benign Het
Gm15737 T A 6: 92,856,701 (GRCm39) C43* probably null Het
Gpr180 T C 14: 118,377,185 (GRCm39) V62A probably benign Het
H2-M11 C T 17: 36,859,042 (GRCm39) T194I possibly damaging Het
Jakmip3 A T 7: 138,591,197 (GRCm39) E27V possibly damaging Het
Kcnq3 T C 15: 65,903,276 (GRCm39) T145A probably damaging Het
Krt8 A G 15: 101,906,459 (GRCm39) M350T probably benign Het
Krtap4-9 T A 11: 99,676,492 (GRCm39) probably benign Het
Lbr G T 1: 181,663,692 (GRCm39) D109E probably damaging Het
Ldc1 A T 4: 130,103,681 (GRCm39) L420Q probably benign Het
Mgat5 A T 1: 127,234,741 (GRCm39) M77L probably benign Het
Mlf1 A T 3: 67,291,919 (GRCm39) N28I possibly damaging Het
Mroh3 A C 1: 136,125,864 (GRCm39) L343R probably damaging Het
Mrpl37 T A 4: 106,921,690 (GRCm39) I180F possibly damaging Het
Mrps27 T A 13: 99,536,836 (GRCm39) C116* probably null Het
Muc6 A G 7: 141,226,651 (GRCm39) S1354P possibly damaging Het
Myh7 A T 14: 55,220,699 (GRCm39) D1033E probably damaging Het
Myo16 A T 8: 10,644,820 (GRCm39) E1717D probably benign Het
Myo1g T A 11: 6,462,539 (GRCm39) probably null Het
Or51ag1 A G 7: 103,155,367 (GRCm39) M262T probably benign Het
Or6c217 A C 10: 129,737,964 (GRCm39) L205R probably damaging Het
Pan2 T C 10: 128,149,766 (GRCm39) L576P probably damaging Het
Parp8 A G 13: 117,032,223 (GRCm39) S278P possibly damaging Het
Pdk2 A G 11: 94,918,028 (GRCm39) probably null Het
Phf1 T C 17: 27,156,062 (GRCm39) S450P probably damaging Het
Pkd1l2 T C 8: 117,746,233 (GRCm39) Y1919C probably damaging Het
Postn T A 3: 54,284,374 (GRCm39) S614T probably damaging Het
Psmg1 A T 16: 95,783,395 (GRCm39) Y213* probably null Het
Rab11b T A 17: 33,966,692 (GRCm39) T203S probably benign Het
Rad54l2 T A 9: 106,580,825 (GRCm39) T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,137,371 (GRCm39) probably benign Het
Rapgef6 A G 11: 54,578,537 (GRCm39) T1028A possibly damaging Het
Rbm6 A G 9: 107,669,197 (GRCm39) S58P possibly damaging Het
Rreb1 G T 13: 38,113,768 (GRCm39) A376S possibly damaging Het
Rsbn1l T A 5: 21,124,767 (GRCm39) N345I probably benign Het
Sf3b2 A T 19: 5,325,118 (GRCm39) S785T possibly damaging Het
Sh2b1 C T 7: 126,068,098 (GRCm39) D519N probably damaging Het
Slitrk6 T C 14: 110,987,704 (GRCm39) T668A probably benign Het
Stkld1 T A 2: 26,840,650 (GRCm39) I444N probably damaging Het
Sucla2 A T 14: 73,790,244 (GRCm39) probably benign Het
Tmem67 T A 4: 12,079,918 (GRCm39) L190F probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trem2 G A 17: 48,658,863 (GRCm39) W191* probably null Het
Ube2d4 A T 15: 58,718,528 (GRCm39) noncoding transcript Het
Uimc1 G T 13: 55,223,617 (GRCm39) D218E probably damaging Het
Wdr62 A T 7: 29,973,424 (GRCm39) V95E probably damaging Het
Zfhx4 T C 3: 5,310,203 (GRCm39) V862A probably damaging Het
Zfp462 T A 4: 55,008,522 (GRCm39) S163T probably benign Het
Zfp704 T C 3: 9,674,553 (GRCm39) D76G unknown Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24,764,482 (GRCm39) missense probably damaging 1.00
IGL00792:Med23 APN 10 24,752,902 (GRCm39) missense possibly damaging 0.93
IGL01289:Med23 APN 10 24,778,019 (GRCm39) missense probably damaging 1.00
IGL01469:Med23 APN 10 24,758,495 (GRCm39) missense probably damaging 1.00
IGL01598:Med23 APN 10 24,779,696 (GRCm39) missense probably benign 0.34
IGL02324:Med23 APN 10 24,773,239 (GRCm39) missense probably damaging 0.98
IGL02381:Med23 APN 10 24,776,626 (GRCm39) missense possibly damaging 0.95
IGL02465:Med23 APN 10 24,779,641 (GRCm39) missense probably damaging 0.96
IGL02554:Med23 APN 10 24,774,473 (GRCm39) critical splice donor site probably null
IGL02683:Med23 APN 10 24,746,615 (GRCm39) missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R0080:Med23 UTSW 10 24,788,715 (GRCm39) missense probably benign 0.33
R0125:Med23 UTSW 10 24,776,686 (GRCm39) missense probably damaging 1.00
R0311:Med23 UTSW 10 24,773,256 (GRCm39) missense possibly damaging 0.95
R0765:Med23 UTSW 10 24,776,608 (GRCm39) missense probably damaging 1.00
R1302:Med23 UTSW 10 24,764,320 (GRCm39) splice site probably null
R1456:Med23 UTSW 10 24,779,550 (GRCm39) splice site probably benign
R1514:Med23 UTSW 10 24,768,565 (GRCm39) splice site probably benign
R1774:Med23 UTSW 10 24,779,584 (GRCm39) missense probably damaging 1.00
R1851:Med23 UTSW 10 24,786,768 (GRCm39) splice site probably null
R1928:Med23 UTSW 10 24,785,710 (GRCm39) missense probably benign
R1975:Med23 UTSW 10 24,786,664 (GRCm39) missense probably benign 0.01
R2011:Med23 UTSW 10 24,755,653 (GRCm39) missense possibly damaging 0.63
R2266:Med23 UTSW 10 24,750,499 (GRCm39) missense probably benign 0.00
R2309:Med23 UTSW 10 24,746,586 (GRCm39) missense probably damaging 0.99
R2507:Med23 UTSW 10 24,786,711 (GRCm39) missense probably damaging 1.00
R3720:Med23 UTSW 10 24,767,018 (GRCm39) missense probably damaging 1.00
R3771:Med23 UTSW 10 24,778,099 (GRCm39) missense probably damaging 1.00
R3811:Med23 UTSW 10 24,768,491 (GRCm39) splice site probably null
R3811:Med23 UTSW 10 24,768,490 (GRCm39) nonsense probably null
R4305:Med23 UTSW 10 24,780,168 (GRCm39) nonsense probably null
R4323:Med23 UTSW 10 24,746,603 (GRCm39) missense probably benign 0.02
R4701:Med23 UTSW 10 24,769,546 (GRCm39) missense probably damaging 1.00
R4886:Med23 UTSW 10 24,750,581 (GRCm39) critical splice donor site probably null
R4925:Med23 UTSW 10 24,786,645 (GRCm39) missense probably damaging 1.00
R4943:Med23 UTSW 10 24,751,567 (GRCm39) missense possibly damaging 0.92
R5207:Med23 UTSW 10 24,771,734 (GRCm39) nonsense probably null
R5749:Med23 UTSW 10 24,764,347 (GRCm39) missense possibly damaging 0.84
R5806:Med23 UTSW 10 24,783,119 (GRCm39) missense probably damaging 1.00
R5896:Med23 UTSW 10 24,778,043 (GRCm39) missense probably damaging 1.00
R5954:Med23 UTSW 10 24,746,381 (GRCm39) splice site probably benign
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6093:Med23 UTSW 10 24,754,341 (GRCm39) missense probably benign 0.16
R6107:Med23 UTSW 10 24,781,932 (GRCm39) nonsense probably null
R6356:Med23 UTSW 10 24,764,311 (GRCm39) missense probably damaging 0.98
R6393:Med23 UTSW 10 24,749,374 (GRCm39) missense possibly damaging 0.91
R6533:Med23 UTSW 10 24,769,518 (GRCm39) missense probably damaging 1.00
R6911:Med23 UTSW 10 24,778,079 (GRCm39) missense probably damaging 0.98
R6981:Med23 UTSW 10 24,771,722 (GRCm39) missense possibly damaging 0.92
R7085:Med23 UTSW 10 24,746,019 (GRCm39) missense probably damaging 1.00
R7215:Med23 UTSW 10 24,764,327 (GRCm39) missense probably benign
R7229:Med23 UTSW 10 24,777,902 (GRCm39) missense probably benign
R7489:Med23 UTSW 10 24,780,254 (GRCm39) missense probably damaging 1.00
R7530:Med23 UTSW 10 24,781,851 (GRCm39) missense probably benign 0.00
R7643:Med23 UTSW 10 24,781,863 (GRCm39) missense probably benign 0.01
R7653:Med23 UTSW 10 24,780,282 (GRCm39) missense probably damaging 1.00
R7764:Med23 UTSW 10 24,785,818 (GRCm39) critical splice donor site probably null
R7784:Med23 UTSW 10 24,778,346 (GRCm39) missense probably damaging 1.00
R8024:Med23 UTSW 10 24,755,581 (GRCm39) missense possibly damaging 0.74
R8182:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R8412:Med23 UTSW 10 24,784,632 (GRCm39) missense probably benign 0.01
R8874:Med23 UTSW 10 24,771,617 (GRCm39) missense possibly damaging 0.92
R8975:Med23 UTSW 10 24,780,334 (GRCm39) missense probably benign 0.42
R9131:Med23 UTSW 10 24,780,279 (GRCm39) missense
R9202:Med23 UTSW 10 24,780,202 (GRCm39) missense probably benign 0.12
R9341:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9342:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R9343:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9412:Med23 UTSW 10 24,778,019 (GRCm39) missense probably damaging 1.00
RF003:Med23 UTSW 10 24,779,683 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAGGCTTTTGGAATACTG -3'
(R):5'- TGTGTGCGTGTACATTCCCC -3'

Sequencing Primer
(F):5'- ACTGTATGTAATCTCTGCCTACAG -3'
(R):5'- GGAAGACTCCTTAGTGGTACTAC -3'
Posted On 2014-12-04