Incidental Mutation 'R2566:Dsp'
ID 254495
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Name desmoplakin
Synonyms DP, 2300002E22Rik, 5730453H04Rik, rul
MMRRC Submission 040425-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2566 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 38335270-38382553 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38380380 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1776 (H1776L)
Ref Sequence ENSEMBL: ENSMUSP00000117252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000124830
AA Change: H2375L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: H2375L

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127906
AA Change: H1776L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: H1776L

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,055,701 (GRCm39) K408E probably damaging Het
2010315B03Rik T A 9: 124,055,783 (GRCm39) K380N probably damaging Het
9230104M06Rik C T 12: 112,964,359 (GRCm39) probably benign Het
Ahi1 T A 10: 20,846,810 (GRCm39) C413* probably null Het
Alms1 T A 6: 85,599,464 (GRCm39) M1430K possibly damaging Het
Ankrd52 G T 10: 128,225,220 (GRCm39) A894S probably benign Het
Arhgap33 C A 7: 30,226,654 (GRCm39) V494L probably damaging Het
Atic G T 1: 71,608,130 (GRCm39) V275F probably damaging Het
Atoh1 T A 6: 64,706,668 (GRCm39) V121E probably damaging Het
Atp5pd T A 11: 115,306,864 (GRCm39) probably null Het
Baiap2l2 A T 15: 79,146,174 (GRCm39) probably null Het
Brca2 A T 5: 150,465,227 (GRCm39) T1664S probably benign Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,395,537 (GRCm39) probably benign Het
Cep350 A T 1: 155,835,464 (GRCm39) probably null Het
Ces2g T C 8: 105,692,621 (GRCm39) probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Cyp2d34 A G 15: 82,500,368 (GRCm39) F457S probably damaging Het
Disp3 T A 4: 148,325,880 (GRCm39) T1293S probably damaging Het
Dock10 T A 1: 80,517,970 (GRCm39) I1348F possibly damaging Het
Efhd1 A T 1: 87,237,477 (GRCm39) Q228L possibly damaging Het
Entpd2 T A 2: 25,289,295 (GRCm39) I259N probably benign Het
Fam149b A T 14: 20,425,578 (GRCm39) M138L probably damaging Het
Fastkd5 T C 2: 130,458,285 (GRCm39) K102E probably benign Het
Fzd7 C A 1: 59,523,695 (GRCm39) T526K possibly damaging Het
G6pd2 T A 5: 61,966,330 (GRCm39) I35N probably damaging Het
Gars1 T A 6: 55,042,548 (GRCm39) M427K probably damaging Het
Gimap4 C T 6: 48,667,799 (GRCm39) R57C probably damaging Het
Gm11232 C A 4: 71,676,022 (GRCm39) W41L probably benign Het
Gm15737 T A 6: 92,856,701 (GRCm39) C43* probably null Het
Gpr180 T C 14: 118,377,185 (GRCm39) V62A probably benign Het
H2-M11 C T 17: 36,859,042 (GRCm39) T194I possibly damaging Het
Jakmip3 A T 7: 138,591,197 (GRCm39) E27V possibly damaging Het
Kcnq3 T C 15: 65,903,276 (GRCm39) T145A probably damaging Het
Krt8 A G 15: 101,906,459 (GRCm39) M350T probably benign Het
Krtap4-9 T A 11: 99,676,492 (GRCm39) probably benign Het
Lbr G T 1: 181,663,692 (GRCm39) D109E probably damaging Het
Ldc1 A T 4: 130,103,681 (GRCm39) L420Q probably benign Het
Med23 A G 10: 24,764,473 (GRCm39) H42R probably damaging Het
Mgat5 A T 1: 127,234,741 (GRCm39) M77L probably benign Het
Mlf1 A T 3: 67,291,919 (GRCm39) N28I possibly damaging Het
Mroh3 A C 1: 136,125,864 (GRCm39) L343R probably damaging Het
Mrpl37 T A 4: 106,921,690 (GRCm39) I180F possibly damaging Het
Mrps27 T A 13: 99,536,836 (GRCm39) C116* probably null Het
Muc6 A G 7: 141,226,651 (GRCm39) S1354P possibly damaging Het
Myh7 A T 14: 55,220,699 (GRCm39) D1033E probably damaging Het
Myo16 A T 8: 10,644,820 (GRCm39) E1717D probably benign Het
Myo1g T A 11: 6,462,539 (GRCm39) probably null Het
Or51ag1 A G 7: 103,155,367 (GRCm39) M262T probably benign Het
Or6c217 A C 10: 129,737,964 (GRCm39) L205R probably damaging Het
Pan2 T C 10: 128,149,766 (GRCm39) L576P probably damaging Het
Parp8 A G 13: 117,032,223 (GRCm39) S278P possibly damaging Het
Pdk2 A G 11: 94,918,028 (GRCm39) probably null Het
Phf1 T C 17: 27,156,062 (GRCm39) S450P probably damaging Het
Pkd1l2 T C 8: 117,746,233 (GRCm39) Y1919C probably damaging Het
Postn T A 3: 54,284,374 (GRCm39) S614T probably damaging Het
Psmg1 A T 16: 95,783,395 (GRCm39) Y213* probably null Het
Rab11b T A 17: 33,966,692 (GRCm39) T203S probably benign Het
Rad54l2 T A 9: 106,580,825 (GRCm39) T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,137,371 (GRCm39) probably benign Het
Rapgef6 A G 11: 54,578,537 (GRCm39) T1028A possibly damaging Het
Rbm6 A G 9: 107,669,197 (GRCm39) S58P possibly damaging Het
Rreb1 G T 13: 38,113,768 (GRCm39) A376S possibly damaging Het
Rsbn1l T A 5: 21,124,767 (GRCm39) N345I probably benign Het
Sf3b2 A T 19: 5,325,118 (GRCm39) S785T possibly damaging Het
Sh2b1 C T 7: 126,068,098 (GRCm39) D519N probably damaging Het
Slitrk6 T C 14: 110,987,704 (GRCm39) T668A probably benign Het
Stkld1 T A 2: 26,840,650 (GRCm39) I444N probably damaging Het
Sucla2 A T 14: 73,790,244 (GRCm39) probably benign Het
Tmem67 T A 4: 12,079,918 (GRCm39) L190F probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trem2 G A 17: 48,658,863 (GRCm39) W191* probably null Het
Ube2d4 A T 15: 58,718,528 (GRCm39) noncoding transcript Het
Uimc1 G T 13: 55,223,617 (GRCm39) D218E probably damaging Het
Wdr62 A T 7: 29,973,424 (GRCm39) V95E probably damaging Het
Zfhx4 T C 3: 5,310,203 (GRCm39) V862A probably damaging Het
Zfp462 T A 4: 55,008,522 (GRCm39) S163T probably benign Het
Zfp704 T C 3: 9,674,553 (GRCm39) D76G unknown Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38,381,822 (GRCm39) missense probably damaging 0.99
IGL01337:Dsp APN 13 38,376,663 (GRCm39) missense probably benign 0.44
IGL01371:Dsp APN 13 38,377,593 (GRCm39) missense probably benign 0.13
IGL01473:Dsp APN 13 38,351,547 (GRCm39) missense probably damaging 0.99
IGL01660:Dsp APN 13 38,360,471 (GRCm39) missense possibly damaging 0.90
IGL01723:Dsp APN 13 38,363,060 (GRCm39) missense probably damaging 1.00
IGL01999:Dsp APN 13 38,365,162 (GRCm39) missense probably damaging 0.99
IGL02313:Dsp APN 13 38,380,499 (GRCm39) nonsense probably null
IGL02833:Dsp APN 13 38,376,897 (GRCm39) missense possibly damaging 0.56
IGL03050:Dsp APN 13 38,372,421 (GRCm39) splice site probably benign
IGL03353:Dsp APN 13 38,370,671 (GRCm39) missense probably damaging 1.00
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0078:Dsp UTSW 13 38,379,993 (GRCm39) missense probably benign 0.22
R0230:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign 0.03
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0285:Dsp UTSW 13 38,356,770 (GRCm39) missense probably benign
R0326:Dsp UTSW 13 38,376,846 (GRCm39) nonsense probably null
R0332:Dsp UTSW 13 38,366,204 (GRCm39) nonsense probably null
R0471:Dsp UTSW 13 38,377,326 (GRCm39) nonsense probably null
R0567:Dsp UTSW 13 38,376,414 (GRCm39) missense probably benign 0.01
R0611:Dsp UTSW 13 38,371,717 (GRCm39) missense probably damaging 1.00
R0718:Dsp UTSW 13 38,380,740 (GRCm39) missense possibly damaging 0.80
R0926:Dsp UTSW 13 38,367,194 (GRCm39) missense probably damaging 0.97
R1078:Dsp UTSW 13 38,367,082 (GRCm39) splice site probably benign
R1183:Dsp UTSW 13 38,375,716 (GRCm39) nonsense probably null
R1188:Dsp UTSW 13 38,378,939 (GRCm39) missense probably damaging 1.00
R1419:Dsp UTSW 13 38,370,671 (GRCm39) missense probably damaging 1.00
R1445:Dsp UTSW 13 38,375,907 (GRCm39) missense probably damaging 0.98
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1478:Dsp UTSW 13 38,365,114 (GRCm39) missense probably damaging 1.00
R1568:Dsp UTSW 13 38,359,123 (GRCm39) missense probably damaging 1.00
R1572:Dsp UTSW 13 38,379,714 (GRCm39) missense probably damaging 1.00
R1676:Dsp UTSW 13 38,377,350 (GRCm39) nonsense probably null
R1736:Dsp UTSW 13 38,376,966 (GRCm39) missense probably benign 0.01
R1776:Dsp UTSW 13 38,380,593 (GRCm39) missense probably damaging 0.99
R1829:Dsp UTSW 13 38,377,171 (GRCm39) missense probably damaging 1.00
R1878:Dsp UTSW 13 38,348,831 (GRCm39) missense possibly damaging 0.53
R2013:Dsp UTSW 13 38,375,434 (GRCm39) missense probably damaging 1.00
R2161:Dsp UTSW 13 38,380,427 (GRCm39) missense probably damaging 1.00
R2187:Dsp UTSW 13 38,360,383 (GRCm39) missense probably damaging 1.00
R2295:Dsp UTSW 13 38,381,022 (GRCm39) missense probably benign 0.28
R2495:Dsp UTSW 13 38,377,453 (GRCm39) missense possibly damaging 0.91
R2888:Dsp UTSW 13 38,376,224 (GRCm39) missense possibly damaging 0.92
R3012:Dsp UTSW 13 38,377,318 (GRCm39) missense possibly damaging 0.61
R3614:Dsp UTSW 13 38,361,175 (GRCm39) missense probably damaging 0.98
R3725:Dsp UTSW 13 38,381,594 (GRCm39) missense probably benign 0.00
R3725:Dsp UTSW 13 38,378,665 (GRCm39) splice site probably null
R3797:Dsp UTSW 13 38,361,260 (GRCm39) critical splice donor site probably null
R3841:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign
R4030:Dsp UTSW 13 38,375,404 (GRCm39) missense possibly damaging 0.84
R4124:Dsp UTSW 13 38,370,689 (GRCm39) missense probably damaging 1.00
R4279:Dsp UTSW 13 38,369,207 (GRCm39) missense probably damaging 1.00
R4334:Dsp UTSW 13 38,380,640 (GRCm39) missense possibly damaging 0.46
R4419:Dsp UTSW 13 38,379,108 (GRCm39) missense probably damaging 1.00
R4615:Dsp UTSW 13 38,375,608 (GRCm39) missense probably damaging 0.98
R4627:Dsp UTSW 13 38,352,617 (GRCm39) missense probably benign 0.01
R4639:Dsp UTSW 13 38,380,760 (GRCm39) missense probably damaging 1.00
R4687:Dsp UTSW 13 38,375,595 (GRCm39) missense probably damaging 1.00
R4735:Dsp UTSW 13 38,380,016 (GRCm39) missense probably damaging 0.99
R4746:Dsp UTSW 13 38,379,080 (GRCm39) missense possibly damaging 0.51
R4772:Dsp UTSW 13 38,351,504 (GRCm39) nonsense probably null
R4830:Dsp UTSW 13 38,376,840 (GRCm39) missense probably benign
R4850:Dsp UTSW 13 38,376,445 (GRCm39) missense probably damaging 1.00
R4959:Dsp UTSW 13 38,375,686 (GRCm39) missense probably benign 0.41
R4963:Dsp UTSW 13 38,381,846 (GRCm39) missense probably damaging 0.99
R4969:Dsp UTSW 13 38,376,886 (GRCm39) missense probably benign 0.00
R4978:Dsp UTSW 13 38,366,210 (GRCm39) missense probably damaging 1.00
R4989:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5068:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5069:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5070:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5133:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5138:Dsp UTSW 13 38,379,821 (GRCm39) missense possibly damaging 0.50
R5138:Dsp UTSW 13 38,367,274 (GRCm39) missense probably benign 0.37
R5153:Dsp UTSW 13 38,366,282 (GRCm39) missense probably damaging 1.00
R5199:Dsp UTSW 13 38,376,878 (GRCm39) nonsense probably null
R5226:Dsp UTSW 13 38,370,746 (GRCm39) missense probably damaging 0.99
R5265:Dsp UTSW 13 38,379,159 (GRCm39) missense possibly damaging 0.95
R5371:Dsp UTSW 13 38,378,865 (GRCm39) missense probably damaging 0.97
R5484:Dsp UTSW 13 38,368,014 (GRCm39) missense possibly damaging 0.48
R5534:Dsp UTSW 13 38,379,818 (GRCm39) missense probably benign 0.01
R5569:Dsp UTSW 13 38,376,628 (GRCm39) missense probably benign 0.01
R5854:Dsp UTSW 13 38,351,477 (GRCm39) splice site probably null
R5910:Dsp UTSW 13 38,376,445 (GRCm39) missense possibly damaging 0.95
R5929:Dsp UTSW 13 38,379,410 (GRCm39) missense possibly damaging 0.92
R5940:Dsp UTSW 13 38,380,002 (GRCm39) missense possibly damaging 0.70
R5948:Dsp UTSW 13 38,379,377 (GRCm39) missense possibly damaging 0.95
R5955:Dsp UTSW 13 38,378,934 (GRCm39) missense possibly damaging 0.73
R5970:Dsp UTSW 13 38,379,678 (GRCm39) missense possibly damaging 0.93
R6054:Dsp UTSW 13 38,351,585 (GRCm39) missense probably benign 0.00
R6113:Dsp UTSW 13 38,376,023 (GRCm39) missense probably damaging 1.00
R6139:Dsp UTSW 13 38,376,382 (GRCm39) missense probably damaging 0.97
R6328:Dsp UTSW 13 38,380,982 (GRCm39) nonsense probably null
R6527:Dsp UTSW 13 38,379,849 (GRCm39) missense probably damaging 1.00
R6573:Dsp UTSW 13 38,380,838 (GRCm39) missense probably damaging 1.00
R6628:Dsp UTSW 13 38,351,598 (GRCm39) missense possibly damaging 0.73
R6738:Dsp UTSW 13 38,376,186 (GRCm39) missense possibly damaging 0.87
R6898:Dsp UTSW 13 38,376,193 (GRCm39) missense possibly damaging 0.59
R6919:Dsp UTSW 13 38,351,631 (GRCm39) missense possibly damaging 0.84
R6951:Dsp UTSW 13 38,351,622 (GRCm39) missense possibly damaging 0.95
R7017:Dsp UTSW 13 38,370,683 (GRCm39) missense probably benign 0.02
R7022:Dsp UTSW 13 38,375,716 (GRCm39) missense probably benign 0.06
R7135:Dsp UTSW 13 38,363,049 (GRCm39) missense probably damaging 1.00
R7192:Dsp UTSW 13 38,379,569 (GRCm39) missense probably benign 0.09
R7211:Dsp UTSW 13 38,372,511 (GRCm39) critical splice donor site probably null
R7251:Dsp UTSW 13 38,377,524 (GRCm39) missense probably benign 0.02
R7326:Dsp UTSW 13 38,376,859 (GRCm39) missense probably benign 0.01
R7369:Dsp UTSW 13 38,381,501 (GRCm39) missense possibly damaging 0.82
R7376:Dsp UTSW 13 38,356,819 (GRCm39) missense probably damaging 1.00
R7406:Dsp UTSW 13 38,381,172 (GRCm39) missense possibly damaging 0.63
R7439:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7439:Dsp UTSW 13 38,360,478 (GRCm39) critical splice donor site probably null
R7441:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7477:Dsp UTSW 13 38,356,839 (GRCm39) missense probably damaging 1.00
R7535:Dsp UTSW 13 38,376,765 (GRCm39) missense probably benign 0.05
R7558:Dsp UTSW 13 38,352,742 (GRCm39) missense probably benign 0.02
R7600:Dsp UTSW 13 38,375,691 (GRCm39) missense probably damaging 1.00
R7616:Dsp UTSW 13 38,375,458 (GRCm39) missense probably damaging 0.98
R7702:Dsp UTSW 13 38,359,183 (GRCm39) missense possibly damaging 0.83
R7738:Dsp UTSW 13 38,369,151 (GRCm39) missense probably damaging 0.97
R7815:Dsp UTSW 13 38,375,446 (GRCm39) missense probably benign 0.31
R7882:Dsp UTSW 13 38,367,994 (GRCm39) missense possibly damaging 0.76
R7917:Dsp UTSW 13 38,351,615 (GRCm39) nonsense probably null
R7971:Dsp UTSW 13 38,376,499 (GRCm39) missense probably damaging 0.97
R8104:Dsp UTSW 13 38,352,600 (GRCm39) missense probably benign 0.03
R8176:Dsp UTSW 13 38,376,786 (GRCm39) missense possibly damaging 0.56
R8303:Dsp UTSW 13 38,381,319 (GRCm39) missense probably benign
R8323:Dsp UTSW 13 38,356,806 (GRCm39) missense possibly damaging 0.80
R8326:Dsp UTSW 13 38,375,611 (GRCm39) missense probably damaging 1.00
R8358:Dsp UTSW 13 38,376,457 (GRCm39) missense possibly damaging 0.92
R8410:Dsp UTSW 13 38,380,791 (GRCm39) missense possibly damaging 0.94
R8552:Dsp UTSW 13 38,369,117 (GRCm39) missense probably damaging 0.98
R8713:Dsp UTSW 13 38,352,701 (GRCm39) missense probably damaging 0.99
R8801:Dsp UTSW 13 38,381,502 (GRCm39) missense possibly damaging 0.81
R8900:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8901:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8968:Dsp UTSW 13 38,335,596 (GRCm39) missense possibly damaging 0.83
R9014:Dsp UTSW 13 38,376,700 (GRCm39) missense possibly damaging 0.83
R9021:Dsp UTSW 13 38,380,808 (GRCm39) missense possibly damaging 0.61
R9030:Dsp UTSW 13 38,352,673 (GRCm39) missense probably damaging 1.00
R9124:Dsp UTSW 13 38,377,276 (GRCm39) missense probably benign 0.42
R9129:Dsp UTSW 13 38,377,126 (GRCm39) missense probably benign 0.09
R9143:Dsp UTSW 13 38,377,337 (GRCm39) missense probably benign 0.05
R9450:Dsp UTSW 13 38,376,379 (GRCm39) missense probably damaging 1.00
R9488:Dsp UTSW 13 38,377,218 (GRCm39) missense probably benign 0.04
R9514:Dsp UTSW 13 38,371,781 (GRCm39) missense probably benign 0.02
R9789:Dsp UTSW 13 38,367,937 (GRCm39) missense probably benign 0.03
R9792:Dsp UTSW 13 38,379,494 (GRCm39) missense possibly damaging 0.87
X0023:Dsp UTSW 13 38,381,660 (GRCm39) missense probably benign 0.00
X0024:Dsp UTSW 13 38,377,231 (GRCm39) missense probably benign 0.04
X0027:Dsp UTSW 13 38,370,622 (GRCm39) missense possibly damaging 0.68
X0067:Dsp UTSW 13 38,366,288 (GRCm39) missense possibly damaging 0.85
Z1176:Dsp UTSW 13 38,381,166 (GRCm39) missense possibly damaging 0.81
Z1177:Dsp UTSW 13 38,376,830 (GRCm39) frame shift probably null
Z1177:Dsp UTSW 13 38,335,665 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTATTGTGGATCCCGTCAGC -3'
(R):5'- ATCTCTCCTTCAGTTGCAGATAGG -3'

Sequencing Primer
(F):5'- CGTCAGCAATTTAAGGCTACCTGTG -3'
(R):5'- CTCCTTCAGTTGCAGATAGGTGAGG -3'
Posted On 2014-12-04