Incidental Mutation 'R0317:Med29'
ID25450
Institutional Source Beutler Lab
Gene Symbol Med29
Ensembl Gene ENSMUSG00000003444
Gene Namemediator complex subunit 29
SynonymsIxl, 2810405O22Rik
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R0317 (G1)
Quality Score214
Status Not validated
Chromosome7
Chromosomal Location28386146-28392708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28386859 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 175 (T175A)
Ref Sequence ENSEMBL: ENSMUSP00000003536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003536
AA Change: T175A

PolyPhen 2 Score 0.477 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003536
Gene: ENSMUSG00000003444
AA Change: T175A

DomainStartEndE-ValueType
Pfam:Med29 51 186 7.3e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208885
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MED29 is a subunit of the Mediator complex, a multiprotein coactivator of RNA transcription that interacts with DNA-bound transcriptional activators, RNA polymerase II (see MIM 180660), and general initiation factors (Sato et al., 2003 [PubMed 14576168]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Med29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Med29 APN 7 28390841 missense possibly damaging 0.95
IGL01644:Med29 APN 7 28390847 missense probably damaging 1.00
IGL02383:Med29 APN 7 28387023 missense possibly damaging 0.91
R0019:Med29 UTSW 7 28391076 splice site probably benign
R0349:Med29 UTSW 7 28392510 small deletion probably benign
R1595:Med29 UTSW 7 28392503 missense probably damaging 1.00
R1723:Med29 UTSW 7 28392705 start gained probably benign
R3237:Med29 UTSW 7 28392621 unclassified probably benign
R4700:Med29 UTSW 7 28386927 missense possibly damaging 0.81
R5665:Med29 UTSW 7 28386814 missense probably benign 0.02
R5870:Med29 UTSW 7 28392497 missense probably damaging 1.00
R6013:Med29 UTSW 7 28386993 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGGCACGGACAAATCAGCAAC -3'
(R):5'- TGACTTTGGCTGCCCATCAGTTTAG -3'

Sequencing Primer
(F):5'- ACAGGAACCACCTGTTTTGC -3'
(R):5'- CATCCAGGAAAGTGATGCTGTTG -3'
Posted On2013-04-16