Incidental Mutation 'R0317:Ggn'
ID 25451
Institutional Source Beutler Lab
Gene Symbol Ggn
Ensembl Gene ENSMUSG00000031493
Gene Name gametogenetin
Synonyms
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0317 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 29170210-29173976 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 29171090 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000146665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033886] [ENSMUST00000048923] [ENSMUST00000059642] [ENSMUST00000098609] [ENSMUST00000182328] [ENSMUST00000186182] [ENSMUST00000208288] [ENSMUST00000208330] [ENSMUST00000209034] [ENSMUST00000209019]
AlphaFold Q80WJ1
Predicted Effect probably benign
Transcript: ENSMUST00000033886
SMART Domains Protein: ENSMUSP00000033886
Gene: ENSMUSG00000031493

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048923
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059642
SMART Domains Protein: ENSMUSP00000051657
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
Pfam:CSN8_PSD8_EIF3K 189 330 1.2e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098609
AA Change: M1K
SMART Domains Protein: ENSMUSP00000096209
Gene: ENSMUSG00000031493
AA Change: M1K

DomainStartEndE-ValueType
Pfam:GGN 38 342 2.1e-158 PFAM
Pfam:GGN 340 709 1.5e-165 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130390
Predicted Effect probably benign
Transcript: ENSMUST00000182328
SMART Domains Protein: ENSMUSP00000138613
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:SAC3_GANP 49 232 1.2e-37 PFAM
Pfam:PCI_Csn8 125 266 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186182
SMART Domains Protein: ENSMUSP00000139514
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
Pfam:SAC3_GANP 113 296 1.3e-37 PFAM
Pfam:PCI_Csn8 189 330 2.3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207778
Predicted Effect probably null
Transcript: ENSMUST00000208288
AA Change: M1K
Predicted Effect probably benign
Transcript: ENSMUST00000208330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208592
Predicted Effect probably benign
Transcript: ENSMUST00000209034
Predicted Effect probably benign
Transcript: ENSMUST00000209019
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a germ cell-specific gene that encodes proteins that interact with POG (proliferation of germ cells). Alternatively spliced transcript variants of a similar mouse gene encode at least three different proteins, namely gametogenetin protein 1a, gametogenetin protein 2, and gametogenetin protein 3, which show a perinuclear, cytoplasmic, and nucleolar localization, respectively. These proteins regulate the localization of POG and may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for this allele exhibit impaired double-strand break repair in spermatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Ggn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0302:Ggn UTSW 7 29171240 splice site probably null
R0376:Ggn UTSW 7 29173022 missense possibly damaging 0.51
R0469:Ggn UTSW 7 29171296 missense probably damaging 1.00
R0581:Ggn UTSW 7 29172304 missense probably benign 0.40
R1375:Ggn UTSW 7 29171941 missense probably damaging 0.97
R1956:Ggn UTSW 7 29171916 missense probably damaging 0.99
R2012:Ggn UTSW 7 29173763 splice site probably null
R4436:Ggn UTSW 7 29171551 missense probably damaging 0.98
R4444:Ggn UTSW 7 29172160 missense probably benign 0.06
R4977:Ggn UTSW 7 29172196 missense probably damaging 1.00
R5762:Ggn UTSW 7 29172352 missense probably damaging 0.98
R5822:Ggn UTSW 7 29172556 missense probably damaging 0.97
R6180:Ggn UTSW 7 29173049 missense probably damaging 0.98
R6294:Ggn UTSW 7 29173848 missense possibly damaging 0.92
R6667:Ggn UTSW 7 29172668 missense possibly damaging 0.71
R6963:Ggn UTSW 7 29171582 missense probably damaging 0.99
R7084:Ggn UTSW 7 29172998 missense probably damaging 0.97
R7242:Ggn UTSW 7 29173034 missense possibly damaging 0.86
R7371:Ggn UTSW 7 29172180 missense probably benign 0.06
Z1186:Ggn UTSW 7 29171475 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTTGAAACTTTCAACAGAGAGGCTGG -3'
(R):5'- TTTCGCCACTTAGATGGCGCAG -3'

Sequencing Primer
(F):5'- AGACTGACTCCTGGAGCCTG -3'
(R):5'- CGAGGGCAGTTCTAAGGTC -3'
Posted On 2013-04-16