Mutagenetix > Incidental Mutation

Incidental Mutation 'R0317:Ggn'

25451

Institutional Source

Beutler Lab

Gene Symbol

Ggn

Ensembl Gene

ENSMUSG00000031493

Gene Name

gametogenetin

Synonyms

MMRRC Submission

038527-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0317 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29170210-29173976 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 29171090 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000146665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033886] [ENSMUST00000048923] [ENSMUST00000059642] [ENSMUST00000098609] [ENSMUST00000182328] [ENSMUST00000186182] [ENSMUST00000208288] [ENSMUST00000208330] [ENSMUST00000209034] [ENSMUST00000209019]

AlphaFold

Q80WJ1

Predicted Effect

probably benign
Transcript: ENSMUST00000033886

SMART Domains

Protein: ENSMUSP00000033886
Gene: ENSMUSG00000031493

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC
low complexity region	84	94	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000048923

SMART Domains

Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

Domain	Start	End	E-Value	Type
Pfam:WH1	1	110	1.6e-13	PFAM
low complexity region	120	130	N/A	INTRINSIC
low complexity region	142	153	N/A	INTRINSIC
Pfam:Sprouty	292	400	7.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000059642

SMART Domains

Protein: ENSMUSP00000051657
Gene: ENSMUSG00000030591

Domain	Start	End	E-Value	Type
low complexity region	11	23	N/A	INTRINSIC
low complexity region	60	82	N/A	INTRINSIC
low complexity region	117	129	N/A	INTRINSIC
Pfam:CSN8_PSD8_EIF3K	189	330	1.2e-40	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000098609
AA Change: M1K

SMART Domains

Protein: ENSMUSP00000096209
Gene: ENSMUSG00000031493
AA Change: M1K

Domain	Start	End	E-Value	Type
Pfam:GGN	38	342	2.1e-158	PFAM
Pfam:GGN	340	709	1.5e-165	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130390

Predicted Effect

probably benign
Transcript: ENSMUST00000182328

SMART Domains

Protein: ENSMUSP00000138613
Gene: ENSMUSG00000030591

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:SAC3_GANP	49	232	1.2e-37	PFAM
Pfam:PCI_Csn8	125	266	4.1e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000186182

SMART Domains

Protein: ENSMUSP00000139514
Gene: ENSMUSG00000030591

Domain	Start	End	E-Value	Type
low complexity region	11	23	N/A	INTRINSIC
low complexity region	60	82	N/A	INTRINSIC
Pfam:SAC3_GANP	113	296	1.3e-37	PFAM
Pfam:PCI_Csn8	189	330	2.3e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207778

Predicted Effect

probably null
Transcript: ENSMUST00000208288
AA Change: M1K

Predicted Effect

probably benign
Transcript: ENSMUST00000208330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208592

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208659

Predicted Effect

probably benign
Transcript: ENSMUST00000209034

Predicted Effect

probably benign
Transcript: ENSMUST00000209019

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a germ cell-specific gene that encodes proteins that interact with POG (proliferation of germ cells). Alternatively spliced transcript variants of a similar mouse gene encode at least three different proteins, namely gametogenetin protein 1a, gametogenetin protein 2, and gametogenetin protein 3, which show a perinuclear, cytoplasmic, and nucleolar localization, respectively. These proteins regulate the localization of POG and may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for this allele exhibit impaired double-strand break repair in spermatocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,293,459	V1774A	probably damaging	Het
Adam34	G	A	8: 43,652,251	P119L	probably benign	Het
Ap3b2	T	C	7: 81,463,681		probably null	Het
Arfip2	G	A	7: 105,637,223	T124M	probably damaging	Het
Arhgef26	T	C	3: 62,423,544	S560P	probably damaging	Het
Bcl11a	A	T	11: 24,172,697		probably null	Het
Cab39	A	G	1: 85,849,160	E322G	probably damaging	Het
Cad	C	A	5: 31,072,321	P1382Q	probably benign	Het
Cc2d2a	T	C	5: 43,706,901		probably null	Het
Cela2a	A	T	4: 141,821,700		probably null	Het
Ces1e	A	C	8: 93,224,039	I38S	probably benign	Het
Ces1f	A	T	8: 93,263,391	F364I	probably benign	Het
Chgb	A	G	2: 132,793,811	T558A	probably benign	Het
Cnpy4	C	T	5: 138,192,812	Q217*	probably null	Het
Col4a3bp	C	T	13: 96,634,121	R487*	probably null	Het
Crlf1	A	G	8: 70,498,599	T43A	probably benign	Het
Dnah7b	T	A	1: 46,134,656	M707K	probably damaging	Het
Ets2	G	A	16: 95,712,149	S123N	probably damaging	Het
Fam196b	C	A	11: 34,402,826	D289E	possibly damaging	Het
Fry	T	C	5: 150,471,468	F304S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,116	R120H	probably benign	Het
Gbf1	A	G	19: 46,254,020	T96A	probably benign	Het
Gm5239	A	G	18: 35,536,916	T112A	probably benign	Het
Kif1bp	A	T	10: 62,578,082		probably null	Het
Lrrc15	A	T	16: 30,273,743	H259Q	probably benign	Het
Lysmd4	A	G	7: 67,226,297	Y236C	probably damaging	Het
Med29	T	C	7: 28,386,859	T175A	possibly damaging	Het
Mfsd12	G	T	10: 81,357,799	D68Y	probably damaging	Het
Myh1	T	C	11: 67,217,512	L1308P	probably damaging	Het
Nphp4	T	A	4: 152,551,931		probably null	Het
Olfr948	A	G	9: 39,319,461	I51T	probably benign	Het
Pdhx	A	G	2: 103,028,280	V393A	probably benign	Het
Pgm5	A	G	19: 24,824,399	I155T	possibly damaging	Het
Pgr	A	T	9: 8,965,022	I889F	probably benign	Het
Phactr4	T	A	4: 132,386,930	K51I	probably damaging	Het
Pum2	T	A	12: 8,728,754	I468K	possibly damaging	Het
Rab11a	A	G	9: 64,725,553	S24P	probably damaging	Het
Rasef	T	C	4: 73,748,562	Q160R	probably damaging	Het
Rbl2	A	G	8: 91,087,144	D339G	probably benign	Het
Recql5	A	G	11: 115,894,673	S666P	probably benign	Het
Rfc1	A	T	5: 65,296,052		probably null	Het
Scarb1	A	G	5: 125,289,692	V59A	probably damaging	Het
Slc2a4	C	T	11: 69,946,356	V85M	probably damaging	Het
Slc6a12	A	G	6: 121,358,625	I291V	possibly damaging	Het
Slco3a1	A	C	7: 74,504,426	Y104D	probably damaging	Het
Suz12	T	A	11: 79,999,078	D13E	probably damaging	Het
Tlr1	G	T	5: 64,925,967	C422*	probably null	Het
Tmco1	T	C	1: 167,325,893	V114A	probably damaging	Het
Trpa1	T	C	1: 14,881,632	T948A	probably benign	Het
Tub	A	T	7: 109,020,927	N93Y	probably damaging	Het
Ufsp2	G	A	8: 45,992,233		probably null	Het
Veph1	T	C	3: 66,171,975	D373G	probably benign	Het
Vmn1r206	A	G	13: 22,620,960	S26P	possibly damaging	Het
Vmn2r1	T	C	3: 64,081,819	S60P	possibly damaging	Het
Wdcp	A	G	12: 4,851,583	S480G	probably benign	Het
Wnk4	T	C	11: 101,268,804	S612P	probably benign	Het
Zfp503	T	C	14: 21,986,459	K130E	probably benign	Het
Zkscan16	G	A	4: 58,957,602	C628Y	possibly damaging	Het

Other mutations in Ggn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0110:Ggn	UTSW	7	29171296	missense	probably damaging	1.00
R0302:Ggn	UTSW	7	29171240	splice site	probably null
R0376:Ggn	UTSW	7	29173022	missense	possibly damaging	0.51
R0469:Ggn	UTSW	7	29171296	missense	probably damaging	1.00
R0581:Ggn	UTSW	7	29172304	missense	probably benign	0.40
R1375:Ggn	UTSW	7	29171941	missense	probably damaging	0.97
R1956:Ggn	UTSW	7	29171916	missense	probably damaging	0.99
R2012:Ggn	UTSW	7	29173763	splice site	probably null
R4436:Ggn	UTSW	7	29171551	missense	probably damaging	0.98
R4444:Ggn	UTSW	7	29172160	missense	probably benign	0.06
R4977:Ggn	UTSW	7	29172196	missense	probably damaging	1.00
R5762:Ggn	UTSW	7	29172352	missense	probably damaging	0.98
R5822:Ggn	UTSW	7	29172556	missense	probably damaging	0.97
R6180:Ggn	UTSW	7	29173049	missense	probably damaging	0.98
R6294:Ggn	UTSW	7	29173848	missense	possibly damaging	0.92
R6667:Ggn	UTSW	7	29172668	missense	possibly damaging	0.71
R6963:Ggn	UTSW	7	29171582	missense	probably damaging	0.99
R7084:Ggn	UTSW	7	29172998	missense	probably damaging	0.97
R7242:Ggn	UTSW	7	29173034	missense	possibly damaging	0.86
R7371:Ggn	UTSW	7	29172180	missense	probably benign	0.06
R9558:Ggn	UTSW	7	29172548	missense	probably damaging	0.99
Z1186:Ggn	UTSW	7	29171475	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTTGAAACTTTCAACAGAGAGGCTGG -3'
(R):5'- TTTCGCCACTTAGATGGCGCAG -3'

Sequencing Primer
(F):5'- AGACTGACTCCTGGAGCCTG -3'
(R):5'- CGAGGGCAGTTCTAAGGTC -3'

Posted On

2013-04-16