Mutagenetix > Incidental Mutations

Incidental Mutation 'R2567:Haus6'

254533

Institutional Source

Beutler Lab

Gene Symbol

Haus6

Ensembl Gene

ENSMUSG00000038047

Gene Name

HAUS augmin-like complex, subunit 6

Synonyms

6230416J20Rik, D4Ertd27e

MMRRC Submission

040426-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.701) question?

Stock #

R2567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86578855-86612055 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 86585885 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 501 (E501*)

Ref Sequence

ENSEMBL: ENSMUSP00000070504 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070607]

Predicted Effect

probably null
Transcript: ENSMUST00000070607
AA Change: E501*

SMART Domains

Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: E501*

Domain	Start	End	E-Value	Type
Pfam:HAUS6_N	14	238	1.1e-77	PFAM
low complexity region	613	624	N/A	INTRINSIC
low complexity region	771	785	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128381

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158333

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	A	G	11: 5,870,251	D409G	probably benign	Het
Akap10	A	G	11: 61,893,349		probably benign	Het
Akap6	G	T	12: 52,938,373	S863I	probably damaging	Het
Ap1s3	T	C	1: 79,625,204	K29E	possibly damaging	Het
Atm	T	A	9: 53,457,470	I2341L	possibly damaging	Het
Atp12a	A	T	14: 56,386,927	D944V	probably damaging	Het
Baz2b	A	T	2: 59,913,911	S1417T	possibly damaging	Het
C130079G13Rik	A	G	3: 59,929,054		probably benign	Het
Cacna1a	T	A	8: 84,549,725	M613K	probably damaging	Het
Ccdc191	A	C	16: 43,943,967		probably null	Het
Cd209d	T	A	8: 3,876,327	N96I	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdk4	T	G	10: 127,064,276	V14G	probably benign	Het
Chrna10	C	A	7: 102,112,069	M438I	probably benign	Het
Clec10a	T	C	11: 70,169,532		probably null	Het
Cog3	A	G	14: 75,754,290	V40A	probably benign	Het
Creb3l3	T	C	10: 81,086,049	H315R	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cubn	A	G	2: 13,278,356		probably null	Het
Cygb	T	C	11: 116,649,866	D98G	probably damaging	Het
Dmbx1	T	C	4: 115,920,292	K120E	probably damaging	Het
Dnah3	T	A	7: 119,952,697	I2800F	possibly damaging	Het
Dntt	G	T	19: 41,041,336	R245L	possibly damaging	Het
Dock1	T	G	7: 135,145,484	V1508G	probably damaging	Het
Enpp4	A	C	17: 44,101,845	I266R	probably damaging	Het
Fhl4	T	C	10: 85,098,780	I46V	possibly damaging	Het
Fn1	G	A	1: 71,597,736	Q1995*	probably null	Het
Foxo1	T	A	3: 52,269,334	L178H	probably damaging	Het
Galnt18	C	T	7: 111,554,616	R267H	probably damaging	Het
Gm1110	T	C	9: 26,920,696	D53G	probably benign	Het
Gm12666	T	C	4: 92,191,323	E87G	probably benign	Het
Gm5294	A	G	5: 138,820,185	S36G	probably null	Het
Gm7104	A	T	12: 88,285,472		noncoding transcript	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Ifna5	T	C	4: 88,835,910	V129A	probably benign	Het
Kdelr3	A	G	15: 79,522,831	I38V	probably benign	Het
Lamb1	A	G	12: 31,269,055		probably null	Het
Mgat4c	T	A	10: 102,378,262	F35L	probably benign	Het
Mmab	A	T	5: 114,433,317	M166K	probably benign	Het
Mrpl2	A	G	17: 46,647,501	T70A	probably benign	Het
Naa11	C	T	5: 97,391,759	G180D	probably benign	Het
Npy6r	T	C	18: 44,275,821	V103A	possibly damaging	Het
Nup188	A	T	2: 30,341,782	R1463W	possibly damaging	Het
Nusap1	T	A	2: 119,643,830	S336R	possibly damaging	Het
Olfr876	T	A	9: 37,804,213	F101I	probably damaging	Het
Pabpc4	T	A	4: 123,297,951	L589Q	probably damaging	Het
Pcdh12	T	A	18: 38,282,096	N659Y	probably damaging	Het
Perm1	T	C	4: 156,217,118	S40P	probably damaging	Het
Phldb1	T	C	9: 44,726,025	T114A	probably damaging	Het
Pirt	C	T	11: 66,926,159	L99F	probably damaging	Het
Plxdc2	A	G	2: 16,712,184	R360G	probably benign	Het
Rhpn2	G	A	7: 35,381,532		probably null	Het
Rpusd2	T	A	2: 119,037,075	I268N	probably damaging	Het
Sds	G	T	5: 120,481,581	W185L	probably damaging	Het
Serpinb5	A	G	1: 106,875,146	K137R	probably benign	Het
Sh3pxd2a	A	G	19: 47,424,569	V25A	possibly damaging	Het
Slc1a2	C	T	2: 102,767,010	T454I	probably damaging	Het
Slc25a40	T	C	5: 8,430,459	C70R	probably damaging	Het
Smoc1	G	A	12: 81,167,590	E260K	probably damaging	Het
Sparcl1	A	T	5: 104,085,088	F616I	probably damaging	Het
Ssc5d	A	T	7: 4,936,335	D590V	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpm2	C	T	10: 77,941,174	V430M	probably damaging	Het
Ttn	T	C	2: 76,744,328	D25407G	probably damaging	Het
Vmn2r68	T	C	7: 85,234,595	I101V	probably benign	Het
Xrcc4	A	T	13: 90,062,142	M61K	probably damaging	Het
Zfp648	A	G	1: 154,204,949	T285A	probably damaging	Het

Other mutations in Haus6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Haus6	APN	4	86607981	missense	probably benign	0.32
IGL02307:Haus6	APN	4	86583835	missense	possibly damaging	0.53
IGL03113:Haus6	APN	4	86583106	nonsense	probably null
IGL03384:Haus6	APN	4	86583525	missense	probably benign
R0436:Haus6	UTSW	4	86585807	missense	probably benign	0.00
R0491:Haus6	UTSW	4	86602846	missense	possibly damaging	0.93
R0620:Haus6	UTSW	4	86583514	missense	possibly damaging	0.53
R1118:Haus6	UTSW	4	86585326	critical splice donor site	probably null
R1969:Haus6	UTSW	4	86604246	missense	probably damaging	0.99
R1985:Haus6	UTSW	4	86593609	missense	possibly damaging	0.96
R2213:Haus6	UTSW	4	86581992	missense	possibly damaging	0.53
R2448:Haus6	UTSW	4	86589001	missense	possibly damaging	0.53
R2760:Haus6	UTSW	4	86583176	nonsense	probably null
R3714:Haus6	UTSW	4	86602867	missense	probably benign	0.01
R3962:Haus6	UTSW	4	86611804	missense	possibly damaging	0.85
R4180:Haus6	UTSW	4	86583574	missense	probably benign	0.00
R4736:Haus6	UTSW	4	86600749	critical splice donor site	probably null
R4738:Haus6	UTSW	4	86600749	critical splice donor site	probably null
R4929:Haus6	UTSW	4	86595433	missense	probably benign	0.03
R4933:Haus6	UTSW	4	86585287	intron	probably benign
R5027:Haus6	UTSW	4	86605696	missense	possibly damaging	0.92
R5199:Haus6	UTSW	4	86582985	missense	possibly damaging	0.85
R5240:Haus6	UTSW	4	86583178	missense	possibly damaging	0.86
R5580:Haus6	UTSW	4	86599266	missense	possibly damaging	0.73
R5781:Haus6	UTSW	4	86601263	missense	possibly damaging	0.92
R5865:Haus6	UTSW	4	86586357	missense	possibly damaging	0.73
R5926:Haus6	UTSW	4	86599316	missense	probably benign
R6154:Haus6	UTSW	4	86583756	missense	possibly damaging	0.96
R7166:Haus6	UTSW	4	86583687	missense	possibly damaging	0.72
R7183:Haus6	UTSW	4	86583752	missense	possibly damaging	0.53
R7418:Haus6	UTSW	4	86594773	missense	possibly damaging	0.73
Z1088:Haus6	UTSW	4	86602874	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- AGGTCCTCTGCAAACCAGTAC -3'
(R):5'- GCTTCAGCTAATTGTGACAGTG -3'

Sequencing Primer
(F):5'- TGCAAACCAGTACATGCTTCTC -3'
(R):5'- TTTGGTGACTTAATTACAGTCAAGG -3'

Posted On

2014-12-04