Incidental Mutation 'R2567:Haus6'
ID254533
Institutional Source Beutler Lab
Gene Symbol Haus6
Ensembl Gene ENSMUSG00000038047
Gene NameHAUS augmin-like complex, subunit 6
Synonyms6230416J20Rik, D4Ertd27e
MMRRC Submission 040426-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R2567 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86578855-86612055 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 86585885 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 501 (E501*)
Ref Sequence ENSEMBL: ENSMUSP00000070504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070607]
Predicted Effect probably null
Transcript: ENSMUST00000070607
AA Change: E501*
SMART Domains Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: E501*

DomainStartEndE-ValueType
Pfam:HAUS6_N 14 238 1.1e-77 PFAM
low complexity region 613 624 N/A INTRINSIC
low complexity region 771 785 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158333
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,251 D409G probably benign Het
Akap10 A G 11: 61,893,349 probably benign Het
Akap6 G T 12: 52,938,373 S863I probably damaging Het
Ap1s3 T C 1: 79,625,204 K29E possibly damaging Het
Atm T A 9: 53,457,470 I2341L possibly damaging Het
Atp12a A T 14: 56,386,927 D944V probably damaging Het
Baz2b A T 2: 59,913,911 S1417T possibly damaging Het
C130079G13Rik A G 3: 59,929,054 probably benign Het
Cacna1a T A 8: 84,549,725 M613K probably damaging Het
Ccdc191 A C 16: 43,943,967 probably null Het
Cd209d T A 8: 3,876,327 N96I probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk4 T G 10: 127,064,276 V14G probably benign Het
Chrna10 C A 7: 102,112,069 M438I probably benign Het
Clec10a T C 11: 70,169,532 probably null Het
Cog3 A G 14: 75,754,290 V40A probably benign Het
Creb3l3 T C 10: 81,086,049 H315R probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cubn A G 2: 13,278,356 probably null Het
Cygb T C 11: 116,649,866 D98G probably damaging Het
Dmbx1 T C 4: 115,920,292 K120E probably damaging Het
Dnah3 T A 7: 119,952,697 I2800F possibly damaging Het
Dntt G T 19: 41,041,336 R245L possibly damaging Het
Dock1 T G 7: 135,145,484 V1508G probably damaging Het
Enpp4 A C 17: 44,101,845 I266R probably damaging Het
Fhl4 T C 10: 85,098,780 I46V possibly damaging Het
Fn1 G A 1: 71,597,736 Q1995* probably null Het
Foxo1 T A 3: 52,269,334 L178H probably damaging Het
Galnt18 C T 7: 111,554,616 R267H probably damaging Het
Gm1110 T C 9: 26,920,696 D53G probably benign Het
Gm12666 T C 4: 92,191,323 E87G probably benign Het
Gm5294 A G 5: 138,820,185 S36G probably null Het
Gm7104 A T 12: 88,285,472 noncoding transcript Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Kdelr3 A G 15: 79,522,831 I38V probably benign Het
Lamb1 A G 12: 31,269,055 probably null Het
Mgat4c T A 10: 102,378,262 F35L probably benign Het
Mmab A T 5: 114,433,317 M166K probably benign Het
Mrpl2 A G 17: 46,647,501 T70A probably benign Het
Naa11 C T 5: 97,391,759 G180D probably benign Het
Npy6r T C 18: 44,275,821 V103A possibly damaging Het
Nup188 A T 2: 30,341,782 R1463W possibly damaging Het
Nusap1 T A 2: 119,643,830 S336R possibly damaging Het
Olfr876 T A 9: 37,804,213 F101I probably damaging Het
Pabpc4 T A 4: 123,297,951 L589Q probably damaging Het
Pcdh12 T A 18: 38,282,096 N659Y probably damaging Het
Perm1 T C 4: 156,217,118 S40P probably damaging Het
Phldb1 T C 9: 44,726,025 T114A probably damaging Het
Pirt C T 11: 66,926,159 L99F probably damaging Het
Plxdc2 A G 2: 16,712,184 R360G probably benign Het
Rhpn2 G A 7: 35,381,532 probably null Het
Rpusd2 T A 2: 119,037,075 I268N probably damaging Het
Sds G T 5: 120,481,581 W185L probably damaging Het
Serpinb5 A G 1: 106,875,146 K137R probably benign Het
Sh3pxd2a A G 19: 47,424,569 V25A possibly damaging Het
Slc1a2 C T 2: 102,767,010 T454I probably damaging Het
Slc25a40 T C 5: 8,430,459 C70R probably damaging Het
Smoc1 G A 12: 81,167,590 E260K probably damaging Het
Sparcl1 A T 5: 104,085,088 F616I probably damaging Het
Ssc5d A T 7: 4,936,335 D590V probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm2 C T 10: 77,941,174 V430M probably damaging Het
Ttn T C 2: 76,744,328 D25407G probably damaging Het
Vmn2r68 T C 7: 85,234,595 I101V probably benign Het
Xrcc4 A T 13: 90,062,142 M61K probably damaging Het
Zfp648 A G 1: 154,204,949 T285A probably damaging Het
Other mutations in Haus6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Haus6 APN 4 86607981 missense probably benign 0.32
IGL02307:Haus6 APN 4 86583835 missense possibly damaging 0.53
IGL03113:Haus6 APN 4 86583106 nonsense probably null
IGL03384:Haus6 APN 4 86583525 missense probably benign
R0436:Haus6 UTSW 4 86585807 missense probably benign 0.00
R0491:Haus6 UTSW 4 86602846 missense possibly damaging 0.93
R0620:Haus6 UTSW 4 86583514 missense possibly damaging 0.53
R1118:Haus6 UTSW 4 86585326 critical splice donor site probably null
R1969:Haus6 UTSW 4 86604246 missense probably damaging 0.99
R1985:Haus6 UTSW 4 86593609 missense possibly damaging 0.96
R2213:Haus6 UTSW 4 86581992 missense possibly damaging 0.53
R2448:Haus6 UTSW 4 86589001 missense possibly damaging 0.53
R2760:Haus6 UTSW 4 86583176 nonsense probably null
R3714:Haus6 UTSW 4 86602867 missense probably benign 0.01
R3962:Haus6 UTSW 4 86611804 missense possibly damaging 0.85
R4180:Haus6 UTSW 4 86583574 missense probably benign 0.00
R4736:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4738:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4929:Haus6 UTSW 4 86595433 missense probably benign 0.03
R4933:Haus6 UTSW 4 86585287 intron probably benign
R5027:Haus6 UTSW 4 86605696 missense possibly damaging 0.92
R5199:Haus6 UTSW 4 86582985 missense possibly damaging 0.85
R5240:Haus6 UTSW 4 86583178 missense possibly damaging 0.86
R5580:Haus6 UTSW 4 86599266 missense possibly damaging 0.73
R5781:Haus6 UTSW 4 86601263 missense possibly damaging 0.92
R5865:Haus6 UTSW 4 86586357 missense possibly damaging 0.73
R5926:Haus6 UTSW 4 86599316 missense probably benign
R6154:Haus6 UTSW 4 86583756 missense possibly damaging 0.96
R7166:Haus6 UTSW 4 86583687 missense possibly damaging 0.72
R7183:Haus6 UTSW 4 86583752 missense possibly damaging 0.53
R7418:Haus6 UTSW 4 86594773 missense possibly damaging 0.73
Z1088:Haus6 UTSW 4 86602874 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGGTCCTCTGCAAACCAGTAC -3'
(R):5'- GCTTCAGCTAATTGTGACAGTG -3'

Sequencing Primer
(F):5'- TGCAAACCAGTACATGCTTCTC -3'
(R):5'- TTTGGTGACTTAATTACAGTCAAGG -3'
Posted On2014-12-04