Mutagenetix > Incidental Mutation

Incidental Mutation 'R2567:Ssc5d'

254546

Institutional Source

Beutler Lab

Gene Symbol

Ssc5d

Ensembl Gene

ENSMUSG00000035279

Gene Name

scavenger receptor cysteine rich family, 5 domains

Synonyms

s5d-srcrb, A430110N23Rik

MMRRC Submission

040426-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4925785-4944826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4936335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 590 (D590V)

Ref Sequence

ENSEMBL: ENSMUSP00000052126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]

AlphaFold

Q8BV57

Predicted Effect

probably damaging
Transcript: ENSMUST00000057612
AA Change: D590V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: D590V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SR	20	120	4.44e-49	SMART
low complexity region	141	155	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
SR	199	299	2.36e-53	SMART
SR	305	405	8.22e-53	SMART
low complexity region	437	462	N/A	INTRINSIC
SR	464	565	1.11e-49	SMART
low complexity region	741	755	N/A	INTRINSIC
SR	758	858	3.93e-50	SMART
low complexity region	936	957	N/A	INTRINSIC
low complexity region	981	1004	N/A	INTRINSIC
low complexity region	1018	1035	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1357	1364	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207310

Predicted Effect

probably benign
Transcript: ENSMUST00000208109

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	A	G	11: 5,870,251	D409G	probably benign	Het
Akap10	A	G	11: 61,893,349		probably benign	Het
Akap6	G	T	12: 52,938,373	S863I	probably damaging	Het
Ap1s3	T	C	1: 79,625,204	K29E	possibly damaging	Het
Atm	T	A	9: 53,457,470	I2341L	possibly damaging	Het
Atp12a	A	T	14: 56,386,927	D944V	probably damaging	Het
Baz2b	A	T	2: 59,913,911	S1417T	possibly damaging	Het
C130079G13Rik	A	G	3: 59,929,054		probably benign	Het
Cacna1a	T	A	8: 84,549,725	M613K	probably damaging	Het
Ccdc191	A	C	16: 43,943,967		probably null	Het
Cd209d	T	A	8: 3,876,327	N96I	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdk4	T	G	10: 127,064,276	V14G	probably benign	Het
Chrna10	C	A	7: 102,112,069	M438I	probably benign	Het
Clec10a	T	C	11: 70,169,532		probably null	Het
Cog3	A	G	14: 75,754,290	V40A	probably benign	Het
Creb3l3	T	C	10: 81,086,049	H315R	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cubn	A	G	2: 13,278,356		probably null	Het
Cygb	T	C	11: 116,649,866	D98G	probably damaging	Het
Dmbx1	T	C	4: 115,920,292	K120E	probably damaging	Het
Dnah3	T	A	7: 119,952,697	I2800F	possibly damaging	Het
Dntt	G	T	19: 41,041,336	R245L	possibly damaging	Het
Dock1	T	G	7: 135,145,484	V1508G	probably damaging	Het
Enpp4	A	C	17: 44,101,845	I266R	probably damaging	Het
Fhl4	T	C	10: 85,098,780	I46V	possibly damaging	Het
Fn1	G	A	1: 71,597,736	Q1995*	probably null	Het
Foxo1	T	A	3: 52,269,334	L178H	probably damaging	Het
Galnt18	C	T	7: 111,554,616	R267H	probably damaging	Het
Gm1110	T	C	9: 26,920,696	D53G	probably benign	Het
Gm12666	T	C	4: 92,191,323	E87G	probably benign	Het
Gm5294	A	G	5: 138,820,185	S36G	probably null	Het
Gm7104	A	T	12: 88,285,472		noncoding transcript	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Haus6	C	A	4: 86,585,885	E501*	probably null	Het
Ifna5	T	C	4: 88,835,910	V129A	probably benign	Het
Kdelr3	A	G	15: 79,522,831	I38V	probably benign	Het
Lamb1	A	G	12: 31,269,055		probably null	Het
Mgat4c	T	A	10: 102,378,262	F35L	probably benign	Het
Mmab	A	T	5: 114,433,317	M166K	probably benign	Het
Mrpl2	A	G	17: 46,647,501	T70A	probably benign	Het
Naa11	C	T	5: 97,391,759	G180D	probably benign	Het
Npy6r	T	C	18: 44,275,821	V103A	possibly damaging	Het
Nup188	A	T	2: 30,341,782	R1463W	possibly damaging	Het
Nusap1	T	A	2: 119,643,830	S336R	possibly damaging	Het
Olfr876	T	A	9: 37,804,213	F101I	probably damaging	Het
Pabpc4	T	A	4: 123,297,951	L589Q	probably damaging	Het
Pcdh12	T	A	18: 38,282,096	N659Y	probably damaging	Het
Perm1	T	C	4: 156,217,118	S40P	probably damaging	Het
Phldb1	T	C	9: 44,726,025	T114A	probably damaging	Het
Pirt	C	T	11: 66,926,159	L99F	probably damaging	Het
Plxdc2	A	G	2: 16,712,184	R360G	probably benign	Het
Rhpn2	G	A	7: 35,381,532		probably null	Het
Rpusd2	T	A	2: 119,037,075	I268N	probably damaging	Het
Sds	G	T	5: 120,481,581	W185L	probably damaging	Het
Serpinb5	A	G	1: 106,875,146	K137R	probably benign	Het
Sh3pxd2a	A	G	19: 47,424,569	V25A	possibly damaging	Het
Slc1a2	C	T	2: 102,767,010	T454I	probably damaging	Het
Slc25a40	T	C	5: 8,430,459	C70R	probably damaging	Het
Smoc1	G	A	12: 81,167,590	E260K	probably damaging	Het
Sparcl1	A	T	5: 104,085,088	F616I	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpm2	C	T	10: 77,941,174	V430M	probably damaging	Het
Ttn	T	C	2: 76,744,328	D25407G	probably damaging	Het
Vmn2r68	T	C	7: 85,234,595	I101V	probably benign	Het
Xrcc4	A	T	13: 90,062,142	M61K	probably damaging	Het
Zfp648	A	G	1: 154,204,949	T285A	probably damaging	Het

Other mutations in Ssc5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Ssc5d	APN	7	4944481	missense	possibly damaging	0.63
IGL00939:Ssc5d	APN	7	4936281	missense	possibly damaging	0.89
IGL01109:Ssc5d	APN	7	4937112	nonsense	probably null
IGL01409:Ssc5d	APN	7	4942809	missense	probably benign	0.16
IGL01880:Ssc5d	APN	7	4933219	missense	probably damaging	1.00
IGL02013:Ssc5d	APN	7	4943836	missense	probably benign	0.00
IGL02227:Ssc5d	APN	7	4933454	critical splice donor site	probably null
IGL02963:Ssc5d	APN	7	4944327	missense	probably benign	0.02
D4043:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
D4216:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
R0104:Ssc5d	UTSW	7	4936286	missense	probably benign	0.41
R0115:Ssc5d	UTSW	7	4927881	unclassified	probably benign
R0201:Ssc5d	UTSW	7	4944663	missense	probably benign
R0365:Ssc5d	UTSW	7	4928467	nonsense	probably null
R0485:Ssc5d	UTSW	7	4937471	missense	probably damaging	0.99
R0967:Ssc5d	UTSW	7	4944343	nonsense	probably null
R1607:Ssc5d	UTSW	7	4944043	missense	probably benign	0.25
R1639:Ssc5d	UTSW	7	4928417	missense	probably damaging	1.00
R1801:Ssc5d	UTSW	7	4936607	missense	probably benign	0.05
R1867:Ssc5d	UTSW	7	4928507	missense	probably damaging	1.00
R1999:Ssc5d	UTSW	7	4942714	missense	possibly damaging	0.86
R2007:Ssc5d	UTSW	7	4928629	missense	probably damaging	1.00
R2084:Ssc5d	UTSW	7	4937012	missense	probably benign	0.01
R2234:Ssc5d	UTSW	7	4943850	missense	probably benign
R2259:Ssc5d	UTSW	7	4943916	missense	probably benign	0.01
R2879:Ssc5d	UTSW	7	4936907	critical splice acceptor site	probably null
R3782:Ssc5d	UTSW	7	4942791	missense	probably benign	0.00
R3875:Ssc5d	UTSW	7	4927262	missense	probably damaging	1.00
R4322:Ssc5d	UTSW	7	4928450	missense	probably damaging	1.00
R4331:Ssc5d	UTSW	7	4942726	missense	probably benign	0.00
R4334:Ssc5d	UTSW	7	4943664	missense	probably benign
R4430:Ssc5d	UTSW	7	4943664	missense	probably benign
R4619:Ssc5d	UTSW	7	4929525	missense	probably damaging	1.00
R4794:Ssc5d	UTSW	7	4943745	missense	probably benign
R5106:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R5174:Ssc5d	UTSW	7	4927971	missense	possibly damaging	0.83
R5553:Ssc5d	UTSW	7	4936290	missense	probably damaging	1.00
R5649:Ssc5d	UTSW	7	4926518	critical splice donor site	probably null
R5786:Ssc5d	UTSW	7	4936818	missense	probably benign	0.00
R6059:Ssc5d	UTSW	7	4942744	missense	possibly damaging	0.86
R6163:Ssc5d	UTSW	7	4927254	missense	probably damaging	1.00
R6332:Ssc5d	UTSW	7	4937522	missense	probably damaging	1.00
R6341:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R6613:Ssc5d	UTSW	7	4933293	missense	possibly damaging	0.82
R7180:Ssc5d	UTSW	7	4936601	missense	probably benign	0.17
R7576:Ssc5d	UTSW	7	4928573	missense	probably damaging	1.00
R7602:Ssc5d	UTSW	7	4942746	missense	possibly damaging	0.95
R7609:Ssc5d	UTSW	7	4927576	missense	possibly damaging	0.56
R7691:Ssc5d	UTSW	7	4944169	missense	probably benign	0.29
R7759:Ssc5d	UTSW	7	4937530	nonsense	probably null
R8480:Ssc5d	UTSW	7	4936329	missense	probably damaging	1.00
R9029:Ssc5d	UTSW	7	4927920	missense	probably damaging	0.97
R9163:Ssc5d	UTSW	7	4933433	missense	probably damaging	1.00
R9178:Ssc5d	UTSW	7	4927059	missense	probably damaging	1.00
R9181:Ssc5d	UTSW	7	4942815	missense	possibly damaging	0.86
R9382:Ssc5d	UTSW	7	4927284	critical splice donor site	probably null
R9489:Ssc5d	UTSW	7	4937600	missense	probably benign	0.02
R9626:Ssc5d	UTSW	7	4943569	missense	probably benign
R9630:Ssc5d	UTSW	7	4936427	missense	probably damaging	1.00
R9776:Ssc5d	UTSW	7	4929368	missense	probably benign	0.07
X0063:Ssc5d	UTSW	7	4936287	missense	probably damaging	1.00
Z1088:Ssc5d	UTSW	7	4928434	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTCTATTTTCTTAAGTGAAACGAGGG -3'
(R):5'- TAACTCAGAGGTACGTGCTGTTG -3'

Sequencing Primer
(F):5'- TTCTTAAGTGAAACGAGGGCGGAG -3'
(R):5'- CTGGGGCCCTGGAATGTTTG -3'

Posted On

2014-12-04