Mutagenetix > Incidental Mutations

Incidental Mutation 'R2567:Cacna1a'

254557

Institutional Source

Beutler Lab

Gene Symbol

Cacna1a

Ensembl Gene

ENSMUSG00000034656

Gene Name

calcium channel, voltage-dependent, P/Q type, alpha 1A subunit

Synonyms

Cacnl1a4, alpha1A, SCA6, nmf352, Ccha1a

MMRRC Submission

040426-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.929) question?

Stock #

R2567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84388440-84640246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84549725 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 613 (M613K)

Ref Sequence

ENSEMBL: ENSMUSP00000112436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]

AlphaFold

P97445

Predicted Effect

probably damaging
Transcript: ENSMUST00000121390
AA Change: M613K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: M613K

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	99	373	1.5e-69	PFAM
Pfam:Ion_trans	488	727	1.2e-54	PFAM
Pfam:PKD_channel	578	721	6.6e-8	PFAM
low complexity region	920	959	N/A	INTRINSIC
low complexity region	977	987	N/A	INTRINSIC
low complexity region	1074	1093	N/A	INTRINSIC
low complexity region	1143	1168	N/A	INTRINSIC
Pfam:Ion_trans	1194	1472	4.9e-64	PFAM
Pfam:Ion_trans	1516	1773	2.8e-64	PFAM
Pfam:GPHH	1775	1844	5.6e-39	PFAM
Ca_chan_IQ	1899	1933	1.8e-12	SMART
AT_hook	2053	2065	2.02e0	SMART
low complexity region	2101	2113	N/A	INTRINSIC
low complexity region	2153	2179	N/A	INTRINSIC
low complexity region	2213	2236	N/A	INTRINSIC
low complexity region	2253	2282	N/A	INTRINSIC
low complexity region	2314	2325	N/A	INTRINSIC
low complexity region	2342	2357	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000122053
AA Change: M566K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: M566K

Domain	Start	End	E-Value	Type
low complexity region	9	47	N/A	INTRINSIC
Pfam:Ion_trans	91	314	4.5e-58	PFAM
PDB:4DEX\|B	317	427	5e-45	PDB
Pfam:Ion_trans	476	668	6.4e-46	PFAM
Pfam:PKD_channel	530	675	7.7e-8	PFAM
low complexity region	873	912	N/A	INTRINSIC
low complexity region	930	940	N/A	INTRINSIC
low complexity region	1027	1046	N/A	INTRINSIC
low complexity region	1096	1121	N/A	INTRINSIC
Pfam:Ion_trans	1183	1414	2.8e-54	PFAM
Pfam:Ion_trans	1504	1714	3.2e-60	PFAM
Ca_chan_IQ	1852	1886	1.8e-12	SMART
AT_hook	2006	2018	2.02e0	SMART
low complexity region	2054	2066	N/A	INTRINSIC
low complexity region	2106	2132	N/A	INTRINSIC
low complexity region	2166	2189	N/A	INTRINSIC
low complexity region	2206	2235	N/A	INTRINSIC
low complexity region	2267	2278	N/A	INTRINSIC
low complexity region	2295	2310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129620

Predicted Effect

unknown
Transcript: ENSMUST00000215756
AA Change: M565K

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	A	G	11: 5,870,251	D409G	probably benign	Het
Akap10	A	G	11: 61,893,349		probably benign	Het
Akap6	G	T	12: 52,938,373	S863I	probably damaging	Het
Ap1s3	T	C	1: 79,625,204	K29E	possibly damaging	Het
Atm	T	A	9: 53,457,470	I2341L	possibly damaging	Het
Atp12a	A	T	14: 56,386,927	D944V	probably damaging	Het
Baz2b	A	T	2: 59,913,911	S1417T	possibly damaging	Het
C130079G13Rik	A	G	3: 59,929,054		probably benign	Het
Ccdc191	A	C	16: 43,943,967		probably null	Het
Cd209d	T	A	8: 3,876,327	N96I	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdk4	T	G	10: 127,064,276	V14G	probably benign	Het
Chrna10	C	A	7: 102,112,069	M438I	probably benign	Het
Clec10a	T	C	11: 70,169,532		probably null	Het
Cog3	A	G	14: 75,754,290	V40A	probably benign	Het
Creb3l3	T	C	10: 81,086,049	H315R	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cubn	A	G	2: 13,278,356		probably null	Het
Cygb	T	C	11: 116,649,866	D98G	probably damaging	Het
Dmbx1	T	C	4: 115,920,292	K120E	probably damaging	Het
Dnah3	T	A	7: 119,952,697	I2800F	possibly damaging	Het
Dntt	G	T	19: 41,041,336	R245L	possibly damaging	Het
Dock1	T	G	7: 135,145,484	V1508G	probably damaging	Het
Enpp4	A	C	17: 44,101,845	I266R	probably damaging	Het
Fhl4	T	C	10: 85,098,780	I46V	possibly damaging	Het
Fn1	G	A	1: 71,597,736	Q1995*	probably null	Het
Foxo1	T	A	3: 52,269,334	L178H	probably damaging	Het
Galnt18	C	T	7: 111,554,616	R267H	probably damaging	Het
Gm1110	T	C	9: 26,920,696	D53G	probably benign	Het
Gm12666	T	C	4: 92,191,323	E87G	probably benign	Het
Gm5294	A	G	5: 138,820,185	S36G	probably null	Het
Gm7104	A	T	12: 88,285,472		noncoding transcript	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Haus6	C	A	4: 86,585,885	E501*	probably null	Het
Ifna5	T	C	4: 88,835,910	V129A	probably benign	Het
Kdelr3	A	G	15: 79,522,831	I38V	probably benign	Het
Lamb1	A	G	12: 31,269,055		probably null	Het
Mgat4c	T	A	10: 102,378,262	F35L	probably benign	Het
Mmab	A	T	5: 114,433,317	M166K	probably benign	Het
Mrpl2	A	G	17: 46,647,501	T70A	probably benign	Het
Naa11	C	T	5: 97,391,759	G180D	probably benign	Het
Npy6r	T	C	18: 44,275,821	V103A	possibly damaging	Het
Nup188	A	T	2: 30,341,782	R1463W	possibly damaging	Het
Nusap1	T	A	2: 119,643,830	S336R	possibly damaging	Het
Olfr876	T	A	9: 37,804,213	F101I	probably damaging	Het
Pabpc4	T	A	4: 123,297,951	L589Q	probably damaging	Het
Pcdh12	T	A	18: 38,282,096	N659Y	probably damaging	Het
Perm1	T	C	4: 156,217,118	S40P	probably damaging	Het
Phldb1	T	C	9: 44,726,025	T114A	probably damaging	Het
Pirt	C	T	11: 66,926,159	L99F	probably damaging	Het
Plxdc2	A	G	2: 16,712,184	R360G	probably benign	Het
Rhpn2	G	A	7: 35,381,532		probably null	Het
Rpusd2	T	A	2: 119,037,075	I268N	probably damaging	Het
Sds	G	T	5: 120,481,581	W185L	probably damaging	Het
Serpinb5	A	G	1: 106,875,146	K137R	probably benign	Het
Sh3pxd2a	A	G	19: 47,424,569	V25A	possibly damaging	Het
Slc1a2	C	T	2: 102,767,010	T454I	probably damaging	Het
Slc25a40	T	C	5: 8,430,459	C70R	probably damaging	Het
Smoc1	G	A	12: 81,167,590	E260K	probably damaging	Het
Sparcl1	A	T	5: 104,085,088	F616I	probably damaging	Het
Ssc5d	A	T	7: 4,936,335	D590V	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpm2	C	T	10: 77,941,174	V430M	probably damaging	Het
Ttn	T	C	2: 76,744,328	D25407G	probably damaging	Het
Vmn2r68	T	C	7: 85,234,595	I101V	probably benign	Het
Xrcc4	A	T	13: 90,062,142	M61K	probably damaging	Het
Zfp648	A	G	1: 154,204,949	T285A	probably damaging	Het

Other mutations in Cacna1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Cacna1a	APN	8	84571208	nonsense	probably null
IGL00513:Cacna1a	APN	8	84553056	missense	probably damaging	1.00
IGL00569:Cacna1a	APN	8	84462714	missense	probably damaging	1.00
IGL00981:Cacna1a	APN	8	84548553	missense	probably damaging	1.00
IGL01122:Cacna1a	APN	8	84614793	critical splice donor site	probably null
IGL01309:Cacna1a	APN	8	84523028	missense	probably damaging	1.00
IGL01380:Cacna1a	APN	8	84559117	missense	probably damaging	1.00
IGL01638:Cacna1a	APN	8	84571827	missense	probably damaging	0.98
IGL01682:Cacna1a	APN	8	84536438	missense	possibly damaging	0.71
IGL02751:Cacna1a	APN	8	84569952	missense	probably damaging	1.00
IGL02904:Cacna1a	APN	8	84579520	missense	probably damaging	1.00
IGL03122:Cacna1a	APN	8	84462676	splice site	probably benign
totter	UTSW	8	84588753	missense	probably damaging	0.99
totter2	UTSW	8	84588753	missense	probably damaging	0.99
FR4340:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638714	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4449:Cacna1a	UTSW	8	84638723	small insertion	probably benign
FR4548:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638720	small insertion	probably benign
FR4737:Cacna1a	UTSW	8	84638726	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638717	small insertion	probably benign
FR4976:Cacna1a	UTSW	8	84638726	small insertion	probably benign
IGL03134:Cacna1a	UTSW	8	84559087	missense	probably damaging	1.00
R0055:Cacna1a	UTSW	8	84580058	splice site	probably benign
R0118:Cacna1a	UTSW	8	84536083	missense	probably damaging	1.00
R0284:Cacna1a	UTSW	8	84612285	missense	probably damaging	1.00
R0581:Cacna1a	UTSW	8	84601936	missense	possibly damaging	0.83
R0607:Cacna1a	UTSW	8	84629831	missense	probably damaging	1.00
R1168:Cacna1a	UTSW	8	84579501	missense	probably damaging	1.00
R1183:Cacna1a	UTSW	8	84580217	missense	probably damaging	1.00
R1470:Cacna1a	UTSW	8	84514950	splice site	probably benign
R1503:Cacna1a	UTSW	8	84601946	missense	probably benign	0.23
R1522:Cacna1a	UTSW	8	84633433	missense	probably benign	0.00
R1835:Cacna1a	UTSW	8	84581357	splice site	probably null
R1862:Cacna1a	UTSW	8	84415930	missense	possibly damaging	0.80
R2148:Cacna1a	UTSW	8	84629675	missense	possibly damaging	0.71
R2237:Cacna1a	UTSW	8	84633765	critical splice donor site	probably null
R2999:Cacna1a	UTSW	8	84567742	missense	probably damaging	1.00
R3025:Cacna1a	UTSW	8	84580225	critical splice donor site	probably null
R3610:Cacna1a	UTSW	8	84559065	missense	probably damaging	1.00
R3702:Cacna1a	UTSW	8	84617846	missense	probably damaging	0.98
R3763:Cacna1a	UTSW	8	84583642	missense	possibly damaging	0.85
R4025:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4026:Cacna1a	UTSW	8	84581333	missense	probably damaging	1.00
R4106:Cacna1a	UTSW	8	84583695	missense	possibly damaging	0.85
R4296:Cacna1a	UTSW	8	84559293	missense	probably damaging	1.00
R4664:Cacna1a	UTSW	8	84601767	nonsense	probably null
R4713:Cacna1a	UTSW	8	84549514	missense	probably damaging	1.00
R5223:Cacna1a	UTSW	8	84587195	missense	possibly damaging	0.94
R5408:Cacna1a	UTSW	8	84549707	missense	probably damaging	1.00
R5644:Cacna1a	UTSW	8	84462777	missense	probably damaging	1.00
R5734:Cacna1a	UTSW	8	84583731	missense	probably damaging	0.96
R5786:Cacna1a	UTSW	8	84415721	unclassified	probably benign
R5833:Cacna1a	UTSW	8	84518697	missense	probably damaging	1.00
R5886:Cacna1a	UTSW	8	84523022	missense	probably damaging	0.99
R6049:Cacna1a	UTSW	8	84638846	missense	probably damaging	0.96
R6054:Cacna1a	UTSW	8	84556785	missense	probably damaging	0.99
R6117:Cacna1a	UTSW	8	84614721	missense	probably damaging	1.00
R6149:Cacna1a	UTSW	8	84569952	missense	probably damaging	1.00
R6195:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6233:Cacna1a	UTSW	8	84588753	missense	probably damaging	0.99
R6607:Cacna1a	UTSW	8	84579492	missense	probably damaging	1.00
R6753:Cacna1a	UTSW	8	84580205	missense	probably damaging	1.00
R6798:Cacna1a	UTSW	8	84611602	missense	probably damaging	1.00
R6831:Cacna1a	UTSW	8	84571231	missense	probably damaging	1.00
R6980:Cacna1a	UTSW	8	84612285	missense	possibly damaging	0.85
R7051:Cacna1a	UTSW	8	84629915	missense	possibly damaging	0.85
R7270:Cacna1a	UTSW	8	84571237	missense	probably damaging	1.00
R7409:Cacna1a	UTSW	8	84533402	missense	probably damaging	1.00
R7491:Cacna1a	UTSW	8	84559293	missense	possibly damaging	0.92
R7511:Cacna1a	UTSW	8	84567682	missense	possibly damaging	0.75
R7745:Cacna1a	UTSW	8	84559394	missense	probably benign	0.01
R7872:Cacna1a	UTSW	8	84583654	missense	probably damaging	1.00
R7899:Cacna1a	UTSW	8	84594173	missense	possibly damaging	0.72
R7986:Cacna1a	UTSW	8	84638779	missense	probably benign	0.02
R8126:Cacna1a	UTSW	8	84633252	missense	probably benign	0.02
R8266:Cacna1a	UTSW	8	84559219	missense	probably damaging	1.00
R8458:Cacna1a	UTSW	8	84549458	missense	probably damaging	1.00
R8504:Cacna1a	UTSW	8	84638741	missense	probably benign
R8530:Cacna1a	UTSW	8	84612414	critical splice donor site	probably null
R8750:Cacna1a	UTSW	8	84559155	missense	probably damaging	0.99
R8817:Cacna1a	UTSW	8	84638797	missense	probably benign	0.44
R8856:Cacna1a	UTSW	8	84559441	missense	probably benign	0.30
R8893:Cacna1a	UTSW	8	84587135	missense	probably benign	0.00
R9083:Cacna1a	UTSW	8	84617882	missense	probably benign	0.30
R9087:Cacna1a	UTSW	8	84638803	missense	probably benign	0.44
R9118:Cacna1a	UTSW	8	84536086	missense	probably damaging	1.00
R9133:Cacna1a	UTSW	8	84549523	missense	probably damaging	1.00
R9175:Cacna1a	UTSW	8	84570015	missense	probably damaging	0.99
R9233:Cacna1a	UTSW	8	84544654	missense	probably damaging	1.00
R9310:Cacna1a	UTSW	8	84536417	missense	probably damaging	1.00
R9331:Cacna1a	UTSW	8	84415817	missense	probably damaging	1.00
R9334:Cacna1a	UTSW	8	84569965	missense	probably damaging	1.00
RF029:Cacna1a	UTSW	8	84638724	small insertion	probably benign
X0022:Cacna1a	UTSW	8	84633699	missense	possibly damaging	0.53
Z1176:Cacna1a	UTSW	8	84415676	missense	unknown
Z1177:Cacna1a	UTSW	8	84579491	missense	probably damaging	1.00
Z1188:Cacna1a	UTSW	8	84515054	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTTGGAATCAGTGTGTTACG -3'
(R):5'- GAGTGTAGTTGTGCAGTGCA -3'

Sequencing Primer
(F):5'- AATCAGTGTGTTACGAGCTCTCAG -3'
(R):5'- CATGTCTGTGTGTCTGTACATGTAC -3'

Posted On

2014-12-04