Mutagenetix > Incidental Mutation

Incidental Mutation 'R2567:Gm1110'

254559

Institutional Source

Beutler Lab

Gene Symbol

Gm1110

Ensembl Gene

ENSMUSG00000079644

Gene Name

predicted gene 1110

Synonyms

LOC382064

MMRRC Submission

040426-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R2567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26879567-26923111 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26920696 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 53 (D53G)

Ref Sequence

ENSEMBL: ENSMUSP00000110916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115261]

AlphaFold

F6Y113

Predicted Effect

probably benign
Transcript: ENSMUST00000115261
AA Change: D53G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: D53G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Glyco_hydro_35	55	368	2e-93	PFAM
Pfam:Glyco_hydro_42	70	229	1e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217197

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	A	G	11: 5,870,251	D409G	probably benign	Het
Akap10	A	G	11: 61,893,349		probably benign	Het
Akap6	G	T	12: 52,938,373	S863I	probably damaging	Het
Ap1s3	T	C	1: 79,625,204	K29E	possibly damaging	Het
Atm	T	A	9: 53,457,470	I2341L	possibly damaging	Het
Atp12a	A	T	14: 56,386,927	D944V	probably damaging	Het
Baz2b	A	T	2: 59,913,911	S1417T	possibly damaging	Het
C130079G13Rik	A	G	3: 59,929,054		probably benign	Het
Cacna1a	T	A	8: 84,549,725	M613K	probably damaging	Het
Ccdc191	A	C	16: 43,943,967		probably null	Het
Cd209d	T	A	8: 3,876,327	N96I	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdk4	T	G	10: 127,064,276	V14G	probably benign	Het
Chrna10	C	A	7: 102,112,069	M438I	probably benign	Het
Clec10a	T	C	11: 70,169,532		probably null	Het
Cog3	A	G	14: 75,754,290	V40A	probably benign	Het
Creb3l3	T	C	10: 81,086,049	H315R	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cubn	A	G	2: 13,278,356		probably null	Het
Cygb	T	C	11: 116,649,866	D98G	probably damaging	Het
Dmbx1	T	C	4: 115,920,292	K120E	probably damaging	Het
Dnah3	T	A	7: 119,952,697	I2800F	possibly damaging	Het
Dntt	G	T	19: 41,041,336	R245L	possibly damaging	Het
Dock1	T	G	7: 135,145,484	V1508G	probably damaging	Het
Enpp4	A	C	17: 44,101,845	I266R	probably damaging	Het
Fhl4	T	C	10: 85,098,780	I46V	possibly damaging	Het
Fn1	G	A	1: 71,597,736	Q1995*	probably null	Het
Foxo1	T	A	3: 52,269,334	L178H	probably damaging	Het
Galnt18	C	T	7: 111,554,616	R267H	probably damaging	Het
Gm12666	T	C	4: 92,191,323	E87G	probably benign	Het
Gm5294	A	G	5: 138,820,185	S36G	probably null	Het
Gm7104	A	T	12: 88,285,472		noncoding transcript	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Haus6	C	A	4: 86,585,885	E501*	probably null	Het
Ifna5	T	C	4: 88,835,910	V129A	probably benign	Het
Kdelr3	A	G	15: 79,522,831	I38V	probably benign	Het
Lamb1	A	G	12: 31,269,055		probably null	Het
Mgat4c	T	A	10: 102,378,262	F35L	probably benign	Het
Mmab	A	T	5: 114,433,317	M166K	probably benign	Het
Mrpl2	A	G	17: 46,647,501	T70A	probably benign	Het
Naa11	C	T	5: 97,391,759	G180D	probably benign	Het
Npy6r	T	C	18: 44,275,821	V103A	possibly damaging	Het
Nup188	A	T	2: 30,341,782	R1463W	possibly damaging	Het
Nusap1	T	A	2: 119,643,830	S336R	possibly damaging	Het
Olfr876	T	A	9: 37,804,213	F101I	probably damaging	Het
Pabpc4	T	A	4: 123,297,951	L589Q	probably damaging	Het
Pcdh12	T	A	18: 38,282,096	N659Y	probably damaging	Het
Perm1	T	C	4: 156,217,118	S40P	probably damaging	Het
Phldb1	T	C	9: 44,726,025	T114A	probably damaging	Het
Pirt	C	T	11: 66,926,159	L99F	probably damaging	Het
Plxdc2	A	G	2: 16,712,184	R360G	probably benign	Het
Rhpn2	G	A	7: 35,381,532		probably null	Het
Rpusd2	T	A	2: 119,037,075	I268N	probably damaging	Het
Sds	G	T	5: 120,481,581	W185L	probably damaging	Het
Serpinb5	A	G	1: 106,875,146	K137R	probably benign	Het
Sh3pxd2a	A	G	19: 47,424,569	V25A	possibly damaging	Het
Slc1a2	C	T	2: 102,767,010	T454I	probably damaging	Het
Slc25a40	T	C	5: 8,430,459	C70R	probably damaging	Het
Smoc1	G	A	12: 81,167,590	E260K	probably damaging	Het
Sparcl1	A	T	5: 104,085,088	F616I	probably damaging	Het
Ssc5d	A	T	7: 4,936,335	D590V	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpm2	C	T	10: 77,941,174	V430M	probably damaging	Het
Ttn	T	C	2: 76,744,328	D25407G	probably damaging	Het
Vmn2r68	T	C	7: 85,234,595	I101V	probably benign	Het
Xrcc4	A	T	13: 90,062,142	M61K	probably damaging	Het
Zfp648	A	G	1: 154,204,949	T285A	probably damaging	Het

Other mutations in Gm1110

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00591:Gm1110	APN	9	26880874	nonsense	probably null
IGL01089:Gm1110	APN	9	26881860	missense	probably benign
IGL01631:Gm1110	APN	9	26897916	critical splice donor site	probably null
IGL02008:Gm1110	APN	9	26883230	missense	probably benign	0.09
IGL02331:Gm1110	APN	9	26913287	critical splice donor site	probably null
IGL02335:Gm1110	APN	9	26881763	missense	probably benign	0.00
IGL02550:Gm1110	APN	9	26881834	missense	probably benign	0.09
IGL02614:Gm1110	APN	9	26920714	missense	probably benign	0.11
IGL03409:Gm1110	APN	9	26896620	missense	probably benign	0.21
PIT4458001:Gm1110	UTSW	9	26880828	missense	probably benign	0.00
R0189:Gm1110	UTSW	9	26883218	missense	probably null	0.99
R0271:Gm1110	UTSW	9	26920666	missense	probably damaging	1.00
R1034:Gm1110	UTSW	9	26921350	missense	probably damaging	1.00
R1229:Gm1110	UTSW	9	26881806	missense	probably benign
R1355:Gm1110	UTSW	9	26883761	missense	probably benign	0.01
R1566:Gm1110	UTSW	9	26880870	missense	probably damaging	1.00
R1574:Gm1110	UTSW	9	26881126	splice site	probably benign
R1916:Gm1110	UTSW	9	26889638	missense	probably damaging	1.00
R2011:Gm1110	UTSW	9	26894258	missense	probably benign	0.01
R2214:Gm1110	UTSW	9	26902490	missense	probably benign	0.37
R2967:Gm1110	UTSW	9	26881043	missense	probably benign	0.05
R4271:Gm1110	UTSW	9	26895648	critical splice donor site	probably null
R4683:Gm1110	UTSW	9	26920594	missense	probably damaging	0.99
R4945:Gm1110	UTSW	9	26920595	missense	possibly damaging	0.46
R5015:Gm1110	UTSW	9	26881866	missense	probably benign	0.01
R5089:Gm1110	UTSW	9	26882387	missense	probably damaging	0.96
R5225:Gm1110	UTSW	9	26902478	missense	probably damaging	1.00
R5239:Gm1110	UTSW	9	26893570	missense	probably benign	0.00
R5395:Gm1110	UTSW	9	26889632	missense	probably benign
R5783:Gm1110	UTSW	9	26882336	missense	probably benign
R6045:Gm1110	UTSW	9	26883209	critical splice donor site	probably null
R6245:Gm1110	UTSW	9	26920747	missense	probably benign	0.04
R6357:Gm1110	UTSW	9	26914128	splice site	probably null
R6863:Gm1110	UTSW	9	26881064	missense	probably damaging	1.00
R7336:Gm1110	UTSW	9	26914357	missense	probably damaging	0.99
R7454:Gm1110	UTSW	9	26920649	missense	probably benign
R7555:Gm1110	UTSW	9	26893628	missense	probably benign	0.05
R7579:Gm1110	UTSW	9	26883826	missense	possibly damaging	0.93
R7990:Gm1110	UTSW	9	26880841	missense	possibly damaging	0.66
R8062:Gm1110	UTSW	9	26881821	missense	probably damaging	0.99
R8108:Gm1110	UTSW	9	26920661	missense	probably damaging	1.00
R8323:Gm1110	UTSW	9	26902423	critical splice donor site	probably null
R8354:Gm1110	UTSW	9	26883280	missense	probably benign	0.01
R8354:Gm1110	UTSW	9	26883281	missense	probably benign	0.00
R8454:Gm1110	UTSW	9	26883280	missense	probably benign	0.01
R8454:Gm1110	UTSW	9	26883281	missense	probably benign	0.00
R8494:Gm1110	UTSW	9	26880858	missense	probably benign	0.04
R8978:Gm1110	UTSW	9	26895799	splice site	probably benign
R9321:Gm1110	UTSW	9	26920595	missense	probably benign	0.00
R9513:Gm1110	UTSW	9	26883787	missense	possibly damaging	0.95
R9545:Gm1110	UTSW	9	26889681	missense	probably benign	0.00
R9758:Gm1110	UTSW	9	26889598	nonsense	probably null
RF002:Gm1110	UTSW	9	26920640	missense	probably damaging	1.00
X0063:Gm1110	UTSW	9	26894280	missense	probably benign	0.01
Z1088:Gm1110	UTSW	9	26913310	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGTCTCAGCTAGGAATTCAGTTG -3'
(R):5'- ACAAATTGATCCCTGTCCCTAG -3'

Sequencing Primer
(F):5'- CTCAGCTAGGAATTCAGTTGAAAAAC -3'
(R):5'- TAGAATCAGGGTGGGCTTTGCATC -3'

Posted On

2014-12-04