Incidental Mutation 'R2567:Gm1110'
ID254559
Institutional Source Beutler Lab
Gene Symbol Gm1110
Ensembl Gene ENSMUSG00000079644
Gene Namepredicted gene 1110
SynonymsLOC382064
MMRRC Submission 040426-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2567 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location26879567-26923111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26920696 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 53 (D53G)
Ref Sequence ENSEMBL: ENSMUSP00000110916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115261]
Predicted Effect probably benign
Transcript: ENSMUST00000115261
AA Change: D53G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: D53G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 55 368 2e-93 PFAM
Pfam:Glyco_hydro_42 70 229 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217197
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,251 D409G probably benign Het
Akap10 A G 11: 61,893,349 probably benign Het
Akap6 G T 12: 52,938,373 S863I probably damaging Het
Ap1s3 T C 1: 79,625,204 K29E possibly damaging Het
Atm T A 9: 53,457,470 I2341L possibly damaging Het
Atp12a A T 14: 56,386,927 D944V probably damaging Het
Baz2b A T 2: 59,913,911 S1417T possibly damaging Het
C130079G13Rik A G 3: 59,929,054 probably benign Het
Cacna1a T A 8: 84,549,725 M613K probably damaging Het
Ccdc191 A C 16: 43,943,967 probably null Het
Cd209d T A 8: 3,876,327 N96I probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk4 T G 10: 127,064,276 V14G probably benign Het
Chrna10 C A 7: 102,112,069 M438I probably benign Het
Clec10a T C 11: 70,169,532 probably null Het
Cog3 A G 14: 75,754,290 V40A probably benign Het
Creb3l3 T C 10: 81,086,049 H315R probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cubn A G 2: 13,278,356 probably null Het
Cygb T C 11: 116,649,866 D98G probably damaging Het
Dmbx1 T C 4: 115,920,292 K120E probably damaging Het
Dnah3 T A 7: 119,952,697 I2800F possibly damaging Het
Dntt G T 19: 41,041,336 R245L possibly damaging Het
Dock1 T G 7: 135,145,484 V1508G probably damaging Het
Enpp4 A C 17: 44,101,845 I266R probably damaging Het
Fhl4 T C 10: 85,098,780 I46V possibly damaging Het
Fn1 G A 1: 71,597,736 Q1995* probably null Het
Foxo1 T A 3: 52,269,334 L178H probably damaging Het
Galnt18 C T 7: 111,554,616 R267H probably damaging Het
Gm12666 T C 4: 92,191,323 E87G probably benign Het
Gm5294 A G 5: 138,820,185 S36G probably null Het
Gm7104 A T 12: 88,285,472 noncoding transcript Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Haus6 C A 4: 86,585,885 E501* probably null Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Kdelr3 A G 15: 79,522,831 I38V probably benign Het
Lamb1 A G 12: 31,269,055 probably null Het
Mgat4c T A 10: 102,378,262 F35L probably benign Het
Mmab A T 5: 114,433,317 M166K probably benign Het
Mrpl2 A G 17: 46,647,501 T70A probably benign Het
Naa11 C T 5: 97,391,759 G180D probably benign Het
Npy6r T C 18: 44,275,821 V103A possibly damaging Het
Nup188 A T 2: 30,341,782 R1463W possibly damaging Het
Nusap1 T A 2: 119,643,830 S336R possibly damaging Het
Olfr876 T A 9: 37,804,213 F101I probably damaging Het
Pabpc4 T A 4: 123,297,951 L589Q probably damaging Het
Pcdh12 T A 18: 38,282,096 N659Y probably damaging Het
Perm1 T C 4: 156,217,118 S40P probably damaging Het
Phldb1 T C 9: 44,726,025 T114A probably damaging Het
Pirt C T 11: 66,926,159 L99F probably damaging Het
Plxdc2 A G 2: 16,712,184 R360G probably benign Het
Rhpn2 G A 7: 35,381,532 probably null Het
Rpusd2 T A 2: 119,037,075 I268N probably damaging Het
Sds G T 5: 120,481,581 W185L probably damaging Het
Serpinb5 A G 1: 106,875,146 K137R probably benign Het
Sh3pxd2a A G 19: 47,424,569 V25A possibly damaging Het
Slc1a2 C T 2: 102,767,010 T454I probably damaging Het
Slc25a40 T C 5: 8,430,459 C70R probably damaging Het
Smoc1 G A 12: 81,167,590 E260K probably damaging Het
Sparcl1 A T 5: 104,085,088 F616I probably damaging Het
Ssc5d A T 7: 4,936,335 D590V probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm2 C T 10: 77,941,174 V430M probably damaging Het
Ttn T C 2: 76,744,328 D25407G probably damaging Het
Vmn2r68 T C 7: 85,234,595 I101V probably benign Het
Xrcc4 A T 13: 90,062,142 M61K probably damaging Het
Zfp648 A G 1: 154,204,949 T285A probably damaging Het
Other mutations in Gm1110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gm1110 APN 9 26880874 nonsense probably null
IGL01089:Gm1110 APN 9 26881860 missense probably benign
IGL01631:Gm1110 APN 9 26897916 critical splice donor site probably null
IGL02008:Gm1110 APN 9 26883230 missense probably benign 0.09
IGL02331:Gm1110 APN 9 26913287 critical splice donor site probably null
IGL02335:Gm1110 APN 9 26881763 missense probably benign 0.00
IGL02550:Gm1110 APN 9 26881834 missense probably benign 0.09
IGL02614:Gm1110 APN 9 26920714 missense probably benign 0.11
IGL03409:Gm1110 APN 9 26896620 missense probably benign 0.21
PIT4458001:Gm1110 UTSW 9 26880828 missense probably benign 0.00
R0189:Gm1110 UTSW 9 26883218 missense probably null 0.99
R0271:Gm1110 UTSW 9 26920666 missense probably damaging 1.00
R1034:Gm1110 UTSW 9 26921350 missense probably damaging 1.00
R1229:Gm1110 UTSW 9 26881806 missense probably benign
R1355:Gm1110 UTSW 9 26883761 missense probably benign 0.01
R1566:Gm1110 UTSW 9 26880870 missense probably damaging 1.00
R1574:Gm1110 UTSW 9 26881126 splice site probably benign
R1916:Gm1110 UTSW 9 26889638 missense probably damaging 1.00
R2011:Gm1110 UTSW 9 26894258 missense probably benign 0.01
R2214:Gm1110 UTSW 9 26902490 missense probably benign 0.37
R2967:Gm1110 UTSW 9 26881043 missense probably benign 0.05
R4271:Gm1110 UTSW 9 26895648 critical splice donor site probably null
R4683:Gm1110 UTSW 9 26920594 missense probably damaging 0.99
R4945:Gm1110 UTSW 9 26920595 missense possibly damaging 0.46
R5015:Gm1110 UTSW 9 26881866 missense probably benign 0.01
R5089:Gm1110 UTSW 9 26882387 missense probably damaging 0.96
R5225:Gm1110 UTSW 9 26902478 missense probably damaging 1.00
R5239:Gm1110 UTSW 9 26893570 missense probably benign 0.00
R5395:Gm1110 UTSW 9 26889632 missense probably benign
R5783:Gm1110 UTSW 9 26882336 missense probably benign
R6045:Gm1110 UTSW 9 26883209 critical splice donor site probably null
R6245:Gm1110 UTSW 9 26920747 missense probably benign 0.04
R6357:Gm1110 UTSW 9 26914128 intron probably null
R6863:Gm1110 UTSW 9 26881064 missense probably damaging 1.00
R7336:Gm1110 UTSW 9 26914357 missense probably damaging 0.99
R7454:Gm1110 UTSW 9 26920649 missense probably benign
R7555:Gm1110 UTSW 9 26893628 missense probably benign 0.05
R7579:Gm1110 UTSW 9 26883826 missense possibly damaging 0.93
RF002:Gm1110 UTSW 9 26920640 missense probably damaging 1.00
X0063:Gm1110 UTSW 9 26894280 missense probably benign 0.01
Z1088:Gm1110 UTSW 9 26913310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCTCAGCTAGGAATTCAGTTG -3'
(R):5'- ACAAATTGATCCCTGTCCCTAG -3'

Sequencing Primer
(F):5'- CTCAGCTAGGAATTCAGTTGAAAAAC -3'
(R):5'- TAGAATCAGGGTGGGCTTTGCATC -3'
Posted On2014-12-04