Mutagenetix > Incidental Mutations

Incidental Mutation 'R0317:Tub'

25456

Institutional Source

Beutler Lab

Gene Symbol

Tub

Ensembl Gene

ENSMUSG00000031028

Gene Name

tubby bipartite transcription factor

Synonyms

rd5, tub

MMRRC Submission

038527-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0317 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

108950338-109034460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 109020927 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 93 (N93Y)

Ref Sequence

ENSEMBL: ENSMUSP00000146894 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000119474] [ENSMUST00000207583]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033341
AA Change: N51Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: N51Y

Domain	Start	End	E-Value	Type
Pfam:Tub_N	29	237	2.5e-58	PFAM
Pfam:Tub	257	499	2.4e-88	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119474
AA Change: N5Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: N5Y

Domain	Start	End	E-Value	Type
low complexity region	24	41	N/A	INTRINSIC
low complexity region	55	77	N/A	INTRINSIC
low complexity region	145	174	N/A	INTRINSIC
low complexity region	183	196	N/A	INTRINSIC
Pfam:Tub	211	453	2.4e-121	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000207583
AA Change: N93Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.4431

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,293,459	V1774A	probably damaging	Het
Adam34	G	A	8: 43,652,251	P119L	probably benign	Het
Ap3b2	T	C	7: 81,463,681		probably null	Het
Arfip2	G	A	7: 105,637,223	T124M	probably damaging	Het
Arhgef26	T	C	3: 62,423,544	S560P	probably damaging	Het
Bcl11a	A	T	11: 24,172,697		probably null	Het
Cab39	A	G	1: 85,849,160	E322G	probably damaging	Het
Cad	C	A	5: 31,072,321	P1382Q	probably benign	Het
Cc2d2a	T	C	5: 43,706,901		probably null	Het
Cela2a	A	T	4: 141,821,700		probably null	Het
Ces1e	A	C	8: 93,224,039	I38S	probably benign	Het
Ces1f	A	T	8: 93,263,391	F364I	probably benign	Het
Chgb	A	G	2: 132,793,811	T558A	probably benign	Het
Cnpy4	C	T	5: 138,192,812	Q217*	probably null	Het
Col4a3bp	C	T	13: 96,634,121	R487*	probably null	Het
Crlf1	A	G	8: 70,498,599	T43A	probably benign	Het
Dnah7b	T	A	1: 46,134,656	M707K	probably damaging	Het
Ets2	G	A	16: 95,712,149	S123N	probably damaging	Het
Fam196b	C	A	11: 34,402,826	D289E	possibly damaging	Het
Fry	T	C	5: 150,471,468	F304S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,116	R120H	probably benign	Het
Gbf1	A	G	19: 46,254,020	T96A	probably benign	Het
Ggn	T	A	7: 29,171,090	M1K	probably null	Het
Gm5239	A	G	18: 35,536,916	T112A	probably benign	Het
Kif1bp	A	T	10: 62,578,082		probably null	Het
Lrrc15	A	T	16: 30,273,743	H259Q	probably benign	Het
Lysmd4	A	G	7: 67,226,297	Y236C	probably damaging	Het
Med29	T	C	7: 28,386,859	T175A	possibly damaging	Het
Mfsd12	G	T	10: 81,357,799	D68Y	probably damaging	Het
Myh1	T	C	11: 67,217,512	L1308P	probably damaging	Het
Nphp4	T	A	4: 152,551,931		probably null	Het
Olfr948	A	G	9: 39,319,461	I51T	probably benign	Het
Pdhx	A	G	2: 103,028,280	V393A	probably benign	Het
Pgm5	A	G	19: 24,824,399	I155T	possibly damaging	Het
Pgr	A	T	9: 8,965,022	I889F	probably benign	Het
Phactr4	T	A	4: 132,386,930	K51I	probably damaging	Het
Pum2	T	A	12: 8,728,754	I468K	possibly damaging	Het
Rab11a	A	G	9: 64,725,553	S24P	probably damaging	Het
Rasef	T	C	4: 73,748,562	Q160R	probably damaging	Het
Rbl2	A	G	8: 91,087,144	D339G	probably benign	Het
Recql5	A	G	11: 115,894,673	S666P	probably benign	Het
Rfc1	A	T	5: 65,296,052		probably null	Het
Scarb1	A	G	5: 125,289,692	V59A	probably damaging	Het
Slc2a4	C	T	11: 69,946,356	V85M	probably damaging	Het
Slc6a12	A	G	6: 121,358,625	I291V	possibly damaging	Het
Slco3a1	A	C	7: 74,504,426	Y104D	probably damaging	Het
Suz12	T	A	11: 79,999,078	D13E	probably damaging	Het
Tlr1	G	T	5: 64,925,967	C422*	probably null	Het
Tmco1	T	C	1: 167,325,893	V114A	probably damaging	Het
Trpa1	T	C	1: 14,881,632	T948A	probably benign	Het
Ufsp2	G	A	8: 45,992,233		probably null	Het
Veph1	T	C	3: 66,171,975	D373G	probably benign	Het
Vmn1r206	A	G	13: 22,620,960	S26P	possibly damaging	Het
Vmn2r1	T	C	3: 64,081,819	S60P	possibly damaging	Het
Wdcp	A	G	12: 4,851,583	S480G	probably benign	Het
Wnk4	T	C	11: 101,268,804	S612P	probably benign	Het
Zfp503	T	C	14: 21,986,459	K130E	probably benign	Het
Zkscan16	G	A	4: 58,957,602	C628Y	possibly damaging	Het

Other mutations in Tub

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01694:Tub	APN	7	109021036	splice site	probably benign
IGL02715:Tub	APN	7	109029310	missense	probably benign
grasso	UTSW	7	109029650	missense	probably damaging	1.00
troy	UTSW	7	109020954	nonsense	probably null
R0152:Tub	UTSW	7	109020927	missense	probably damaging	1.00
R0233:Tub	UTSW	7	109029341	missense	possibly damaging	0.63
R0233:Tub	UTSW	7	109029341	missense	possibly damaging	0.63
R1382:Tub	UTSW	7	109030153	missense	probably damaging	1.00
R1395:Tub	UTSW	7	109020954	nonsense	probably null
R1588:Tub	UTSW	7	109029681	missense	probably damaging	1.00
R1975:Tub	UTSW	7	109027835	missense	possibly damaging	0.74
R2047:Tub	UTSW	7	109026732	missense	probably benign	0.30
R2121:Tub	UTSW	7	109026737	missense	probably damaging	1.00
R2414:Tub	UTSW	7	109027033	missense	probably damaging	1.00
R3694:Tub	UTSW	7	109027832	missense	probably benign
R3695:Tub	UTSW	7	109027832	missense	probably benign
R4914:Tub	UTSW	7	109020954	nonsense	probably null
R5139:Tub	UTSW	7	109011102	start codon destroyed	probably null	0.53
R5347:Tub	UTSW	7	109026771	missense	possibly damaging	0.67
R5557:Tub	UTSW	7	109025718	missense	probably damaging	0.99
R6000:Tub	UTSW	7	109029650	missense	probably damaging	1.00
R6245:Tub	UTSW	7	109027058	missense	probably damaging	1.00
R6888:Tub	UTSW	7	109029298	missense	probably null	1.00
R7316:Tub	UTSW	7	109030171	missense	possibly damaging	0.69
R8120:Tub	UTSW	7	109025596	splice site	probably null
R8223:Tub	UTSW	7	109029326	missense	probably benign	0.33
RF005:Tub	UTSW	7	109022639	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTGACAGCTAGTCAGAAGATGCC -3'
(R):5'- ACAGGATGAATCCCTAAGCTCCGC -3'

Sequencing Primer
(F):5'- GATGCCAATAACATGAGTCCTG -3'
(R):5'- AGTCCCCCTAGCATCCTGAC -3'

Posted On

2013-04-16