Incidental Mutation 'R2567:Aebp1'
ID254569
Institutional Source Beutler Lab
Gene Symbol Aebp1
Ensembl Gene ENSMUSG00000020473
Gene NameAE binding protein 1
SynonymsACLP
MMRRC Submission 040426-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2567 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5861947-5872088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5870251 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 409 (D409G)
Ref Sequence ENSEMBL: ENSMUSP00000105454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102922] [ENSMUST00000102923] [ENSMUST00000109829] [ENSMUST00000153995]
Predicted Effect probably benign
Transcript: ENSMUST00000102922
SMART Domains Protein: ENSMUSP00000099986
Gene: ENSMUSG00000020471

DomainStartEndE-ValueType
Pfam:DNA_pol_E_B 196 412 1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102923
AA Change: D789G

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473
AA Change: D789G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 46 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
low complexity region 113 159 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 264 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
FA58C 375 531 8.72e-46 SMART
Zn_pept 555 983 5.56e-43 SMART
low complexity region 1005 1029 N/A INTRINSIC
low complexity region 1035 1052 N/A INTRINSIC
low complexity region 1069 1089 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109829
AA Change: D409G

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473
AA Change: D409G

DomainStartEndE-ValueType
FA58C 1 151 2.04e-37 SMART
Zn_pept 175 603 5.56e-43 SMART
low complexity region 625 649 N/A INTRINSIC
low complexity region 655 672 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141907
Predicted Effect probably benign
Transcript: ENSMUST00000153995
SMART Domains Protein: ENSMUSP00000122906
Gene: ENSMUSG00000020471

DomainStartEndE-ValueType
PDB:3E0J|G 1 241 1e-142 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of carboxypeptidase A protein family. The encoded protein may function as a transcriptional repressor and play a role in adipogenesis and smooth muscle cell differentiation. Studies in mice suggest that this gene functions in wound healing and abdominal wall development. Overexpression of this gene is associated with glioblastoma. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one null allele exhibit neonatal lethality, abdominal wall herniation, extrusion of the abdominal organs, and defects in wound healing. Mice homozygous for another null allele exhibit embryonic lethality, decreased white adipose tissue, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap10 A G 11: 61,893,349 probably benign Het
Akap6 G T 12: 52,938,373 S863I probably damaging Het
Ap1s3 T C 1: 79,625,204 K29E possibly damaging Het
Atm T A 9: 53,457,470 I2341L possibly damaging Het
Atp12a A T 14: 56,386,927 D944V probably damaging Het
Baz2b A T 2: 59,913,911 S1417T possibly damaging Het
C130079G13Rik A G 3: 59,929,054 probably benign Het
Cacna1a T A 8: 84,549,725 M613K probably damaging Het
Ccdc191 A C 16: 43,943,967 probably null Het
Cd209d T A 8: 3,876,327 N96I probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk4 T G 10: 127,064,276 V14G probably benign Het
Chrna10 C A 7: 102,112,069 M438I probably benign Het
Clec10a T C 11: 70,169,532 probably null Het
Cog3 A G 14: 75,754,290 V40A probably benign Het
Creb3l3 T C 10: 81,086,049 H315R probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cubn A G 2: 13,278,356 probably null Het
Cygb T C 11: 116,649,866 D98G probably damaging Het
Dmbx1 T C 4: 115,920,292 K120E probably damaging Het
Dnah3 T A 7: 119,952,697 I2800F possibly damaging Het
Dntt G T 19: 41,041,336 R245L possibly damaging Het
Dock1 T G 7: 135,145,484 V1508G probably damaging Het
Enpp4 A C 17: 44,101,845 I266R probably damaging Het
Fhl4 T C 10: 85,098,780 I46V possibly damaging Het
Fn1 G A 1: 71,597,736 Q1995* probably null Het
Foxo1 T A 3: 52,269,334 L178H probably damaging Het
Galnt18 C T 7: 111,554,616 R267H probably damaging Het
Gm1110 T C 9: 26,920,696 D53G probably benign Het
Gm12666 T C 4: 92,191,323 E87G probably benign Het
Gm5294 A G 5: 138,820,185 S36G probably null Het
Gm7104 A T 12: 88,285,472 noncoding transcript Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Haus6 C A 4: 86,585,885 E501* probably null Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Kdelr3 A G 15: 79,522,831 I38V probably benign Het
Lamb1 A G 12: 31,269,055 probably null Het
Mgat4c T A 10: 102,378,262 F35L probably benign Het
Mmab A T 5: 114,433,317 M166K probably benign Het
Mrpl2 A G 17: 46,647,501 T70A probably benign Het
Naa11 C T 5: 97,391,759 G180D probably benign Het
Npy6r T C 18: 44,275,821 V103A possibly damaging Het
Nup188 A T 2: 30,341,782 R1463W possibly damaging Het
Nusap1 T A 2: 119,643,830 S336R possibly damaging Het
Olfr876 T A 9: 37,804,213 F101I probably damaging Het
Pabpc4 T A 4: 123,297,951 L589Q probably damaging Het
Pcdh12 T A 18: 38,282,096 N659Y probably damaging Het
Perm1 T C 4: 156,217,118 S40P probably damaging Het
Phldb1 T C 9: 44,726,025 T114A probably damaging Het
Pirt C T 11: 66,926,159 L99F probably damaging Het
Plxdc2 A G 2: 16,712,184 R360G probably benign Het
Rhpn2 G A 7: 35,381,532 probably null Het
Rpusd2 T A 2: 119,037,075 I268N probably damaging Het
Sds G T 5: 120,481,581 W185L probably damaging Het
Serpinb5 A G 1: 106,875,146 K137R probably benign Het
Sh3pxd2a A G 19: 47,424,569 V25A possibly damaging Het
Slc1a2 C T 2: 102,767,010 T454I probably damaging Het
Slc25a40 T C 5: 8,430,459 C70R probably damaging Het
Smoc1 G A 12: 81,167,590 E260K probably damaging Het
Sparcl1 A T 5: 104,085,088 F616I probably damaging Het
Ssc5d A T 7: 4,936,335 D590V probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm2 C T 10: 77,941,174 V430M probably damaging Het
Ttn T C 2: 76,744,328 D25407G probably damaging Het
Vmn2r68 T C 7: 85,234,595 I101V probably benign Het
Xrcc4 A T 13: 90,062,142 M61K probably damaging Het
Zfp648 A G 1: 154,204,949 T285A probably damaging Het
Other mutations in Aebp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Aebp1 APN 11 5871787 missense possibly damaging 0.67
IGL01464:Aebp1 APN 11 5869822 missense possibly damaging 0.46
IGL01561:Aebp1 APN 11 5871349 missense probably damaging 1.00
IGL01648:Aebp1 APN 11 5870607 missense possibly damaging 0.96
IGL01950:Aebp1 APN 11 5869108 missense probably benign 0.02
IGL02094:Aebp1 APN 11 5868357 missense probably benign 0.17
IGL02585:Aebp1 APN 11 5870855 splice site probably null
R0006:Aebp1 UTSW 11 5863935 unclassified probably benign
R0551:Aebp1 UTSW 11 5867955 missense probably benign 0.04
R1144:Aebp1 UTSW 11 5868475 missense probably benign 0.17
R1265:Aebp1 UTSW 11 5871740 missense probably damaging 0.98
R1297:Aebp1 UTSW 11 5870834 missense possibly damaging 0.69
R1518:Aebp1 UTSW 11 5871469 missense possibly damaging 0.58
R1524:Aebp1 UTSW 11 5870089 missense probably damaging 0.98
R3155:Aebp1 UTSW 11 5871425 missense probably benign 0.16
R4415:Aebp1 UTSW 11 5865451 missense probably damaging 0.96
R4507:Aebp1 UTSW 11 5870565 missense probably damaging 1.00
R5248:Aebp1 UTSW 11 5868501 missense possibly damaging 0.63
R5597:Aebp1 UTSW 11 5866487 missense probably benign 0.01
R5809:Aebp1 UTSW 11 5870257 missense probably benign
R5919:Aebp1 UTSW 11 5871421 missense probably benign 0.00
R5982:Aebp1 UTSW 11 5867911 missense possibly damaging 0.69
R6139:Aebp1 UTSW 11 5871842 missense probably damaging 1.00
R7067:Aebp1 UTSW 11 5866431 critical splice acceptor site probably null
R7289:Aebp1 UTSW 11 5865059 missense probably damaging 1.00
R7383:Aebp1 UTSW 11 5868548 missense probably damaging 1.00
R7437:Aebp1 UTSW 11 5869757 missense possibly damaging 0.50
Z1088:Aebp1 UTSW 11 5871460 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAGGATGTGCTCACAGACG -3'
(R):5'- AGAGCGAGGATTCCACTTGG -3'

Sequencing Primer
(F):5'- TCCCTAGGTCTCCACAGAAGTC -3'
(R):5'- ACTTGGCCCCGTTGACAATG -3'
Posted On2014-12-04