Incidental Mutation 'R2567:Smoc1'
ID254578
Institutional Source Beutler Lab
Gene Symbol Smoc1
Ensembl Gene ENSMUSG00000021136
Gene NameSPARC related modular calcium binding 1
Synonyms2600002F22Rik, SPARC-related protein, SRG
MMRRC Submission 040426-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2567 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location81026808-81186414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81167590 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 260 (E260K)
Ref Sequence ENSEMBL: ENSMUSP00000105976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021564] [ENSMUST00000110347] [ENSMUST00000129362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021564
AA Change: E249K

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021564
Gene: ENSMUSG00000021136
AA Change: E249K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110347
AA Change: E260K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105976
Gene: ENSMUSG00000021136
AA Change: E260K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 258 306 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 323 434 2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129362
AA Change: E249K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122858
Gene: ENSMUSG00000021136
AA Change: E249K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174932
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain secreted protein that may have a critical role in ocular and limb development. Mutations in this gene are associated with microphthalmia and limb anomalies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a transposon-induced allele exhibit ocular and limb defects. Mice homozygous for a knock-out allele exhibit neonatal lethality, osseous syndactyly, decreased body size, and iris and retina coloboma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,870,251 D409G probably benign Het
Akap10 A G 11: 61,893,349 probably benign Het
Akap6 G T 12: 52,938,373 S863I probably damaging Het
Ap1s3 T C 1: 79,625,204 K29E possibly damaging Het
Atm T A 9: 53,457,470 I2341L possibly damaging Het
Atp12a A T 14: 56,386,927 D944V probably damaging Het
Baz2b A T 2: 59,913,911 S1417T possibly damaging Het
C130079G13Rik A G 3: 59,929,054 probably benign Het
Cacna1a T A 8: 84,549,725 M613K probably damaging Het
Ccdc191 A C 16: 43,943,967 probably null Het
Cd209d T A 8: 3,876,327 N96I probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdk4 T G 10: 127,064,276 V14G probably benign Het
Chrna10 C A 7: 102,112,069 M438I probably benign Het
Clec10a T C 11: 70,169,532 probably null Het
Cog3 A G 14: 75,754,290 V40A probably benign Het
Creb3l3 T C 10: 81,086,049 H315R probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cubn A G 2: 13,278,356 probably null Het
Cygb T C 11: 116,649,866 D98G probably damaging Het
Dmbx1 T C 4: 115,920,292 K120E probably damaging Het
Dnah3 T A 7: 119,952,697 I2800F possibly damaging Het
Dntt G T 19: 41,041,336 R245L possibly damaging Het
Dock1 T G 7: 135,145,484 V1508G probably damaging Het
Enpp4 A C 17: 44,101,845 I266R probably damaging Het
Fhl4 T C 10: 85,098,780 I46V possibly damaging Het
Fn1 G A 1: 71,597,736 Q1995* probably null Het
Foxo1 T A 3: 52,269,334 L178H probably damaging Het
Galnt18 C T 7: 111,554,616 R267H probably damaging Het
Gm1110 T C 9: 26,920,696 D53G probably benign Het
Gm12666 T C 4: 92,191,323 E87G probably benign Het
Gm5294 A G 5: 138,820,185 S36G probably null Het
Gm7104 A T 12: 88,285,472 noncoding transcript Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Haus6 C A 4: 86,585,885 E501* probably null Het
Ifna5 T C 4: 88,835,910 V129A probably benign Het
Kdelr3 A G 15: 79,522,831 I38V probably benign Het
Lamb1 A G 12: 31,269,055 probably null Het
Mgat4c T A 10: 102,378,262 F35L probably benign Het
Mmab A T 5: 114,433,317 M166K probably benign Het
Mrpl2 A G 17: 46,647,501 T70A probably benign Het
Naa11 C T 5: 97,391,759 G180D probably benign Het
Npy6r T C 18: 44,275,821 V103A possibly damaging Het
Nup188 A T 2: 30,341,782 R1463W possibly damaging Het
Nusap1 T A 2: 119,643,830 S336R possibly damaging Het
Olfr876 T A 9: 37,804,213 F101I probably damaging Het
Pabpc4 T A 4: 123,297,951 L589Q probably damaging Het
Pcdh12 T A 18: 38,282,096 N659Y probably damaging Het
Perm1 T C 4: 156,217,118 S40P probably damaging Het
Phldb1 T C 9: 44,726,025 T114A probably damaging Het
Pirt C T 11: 66,926,159 L99F probably damaging Het
Plxdc2 A G 2: 16,712,184 R360G probably benign Het
Rhpn2 G A 7: 35,381,532 probably null Het
Rpusd2 T A 2: 119,037,075 I268N probably damaging Het
Sds G T 5: 120,481,581 W185L probably damaging Het
Serpinb5 A G 1: 106,875,146 K137R probably benign Het
Sh3pxd2a A G 19: 47,424,569 V25A possibly damaging Het
Slc1a2 C T 2: 102,767,010 T454I probably damaging Het
Slc25a40 T C 5: 8,430,459 C70R probably damaging Het
Sparcl1 A T 5: 104,085,088 F616I probably damaging Het
Ssc5d A T 7: 4,936,335 D590V probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpm2 C T 10: 77,941,174 V430M probably damaging Het
Ttn T C 2: 76,744,328 D25407G probably damaging Het
Vmn2r68 T C 7: 85,234,595 I101V probably benign Het
Xrcc4 A T 13: 90,062,142 M61K probably damaging Het
Zfp648 A G 1: 154,204,949 T285A probably damaging Het
Other mutations in Smoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Smoc1 APN 12 81152751 nonsense probably null
R1291:Smoc1 UTSW 12 81179591 missense probably damaging 0.97
R1902:Smoc1 UTSW 12 81104671 missense probably benign 0.32
R2109:Smoc1 UTSW 12 81150676 missense probably damaging 0.99
R3900:Smoc1 UTSW 12 81167513 missense probably damaging 0.98
R4663:Smoc1 UTSW 12 81167602 missense probably damaging 1.00
R4762:Smoc1 UTSW 12 81167651 missense probably damaging 1.00
R4767:Smoc1 UTSW 12 81104773 critical splice donor site probably null
R4836:Smoc1 UTSW 12 81179548 missense probably damaging 1.00
R5264:Smoc1 UTSW 12 81104700 missense probably damaging 0.99
R5839:Smoc1 UTSW 12 81167585 missense probably damaging 1.00
R5898:Smoc1 UTSW 12 81104757 nonsense probably null
R7359:Smoc1 UTSW 12 81150701 missense probably damaging 1.00
R7611:Smoc1 UTSW 12 81179670 missense probably damaging 1.00
R7655:Smoc1 UTSW 12 81105908 missense possibly damaging 0.95
R7656:Smoc1 UTSW 12 81105908 missense possibly damaging 0.95
V8831:Smoc1 UTSW 12 81168255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGGGATGATTCACGGTTC -3'
(R):5'- AGTCTCCTGTGACTTGAGTCTG -3'

Sequencing Primer
(F):5'- CACGGTTCTTTGGGGGCAG -3'
(R):5'- CTCCTGTGACTTGAGTCTGTGAGAAG -3'
Posted On2014-12-04