Mutagenetix > Incidental Mutations

Incidental Mutation 'R2567:Pcdh12'

254592

Institutional Source

Beutler Lab

Gene Symbol

Pcdh12

Ensembl Gene

ENSMUSG00000024440

Gene Name

protocadherin 12

Synonyms

VE-cadherin-2, vascular endothelial cadherin-2

MMRRC Submission

040426-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38267092-38284402 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 38282096 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 659 (N659Y)

Ref Sequence

ENSEMBL: ENSMUSP00000025311 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025311
AA Change: N659Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: N659Y

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
CA	53	133	4.42e-2	SMART
CA	157	242	2.55e-17	SMART
CA	266	350	2.31e-24	SMART
CA	376	458	3.86e-26	SMART
CA	482	563	6.27e-26	SMART
CA	621	704	3.02e-2	SMART
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	960	975	N/A	INTRINSIC
low complexity region	1032	1041	N/A	INTRINSIC
low complexity region	1115	1125	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193123

Predicted Effect

probably benign
Transcript: ENSMUST00000194012

SMART Domains

Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

Domain	Start	End	E-Value	Type
low complexity region	56	66	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195747

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aebp1	A	G	11: 5,870,251	D409G	probably benign	Het
Akap10	A	G	11: 61,893,349		probably benign	Het
Akap6	G	T	12: 52,938,373	S863I	probably damaging	Het
Ap1s3	T	C	1: 79,625,204	K29E	possibly damaging	Het
Atm	T	A	9: 53,457,470	I2341L	possibly damaging	Het
Atp12a	A	T	14: 56,386,927	D944V	probably damaging	Het
Baz2b	A	T	2: 59,913,911	S1417T	possibly damaging	Het
C130079G13Rik	A	G	3: 59,929,054		probably benign	Het
Cacna1a	T	A	8: 84,549,725	M613K	probably damaging	Het
Ccdc191	A	C	16: 43,943,967		probably null	Het
Cd209d	T	A	8: 3,876,327	N96I	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cdk4	T	G	10: 127,064,276	V14G	probably benign	Het
Chrna10	C	A	7: 102,112,069	M438I	probably benign	Het
Clec10a	T	C	11: 70,169,532		probably null	Het
Cog3	A	G	14: 75,754,290	V40A	probably benign	Het
Creb3l3	T	C	10: 81,086,049	H315R	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cubn	A	G	2: 13,278,356		probably null	Het
Cygb	T	C	11: 116,649,866	D98G	probably damaging	Het
Dmbx1	T	C	4: 115,920,292	K120E	probably damaging	Het
Dnah3	T	A	7: 119,952,697	I2800F	possibly damaging	Het
Dntt	G	T	19: 41,041,336	R245L	possibly damaging	Het
Dock1	T	G	7: 135,145,484	V1508G	probably damaging	Het
Enpp4	A	C	17: 44,101,845	I266R	probably damaging	Het
Fhl4	T	C	10: 85,098,780	I46V	possibly damaging	Het
Fn1	G	A	1: 71,597,736	Q1995*	probably null	Het
Foxo1	T	A	3: 52,269,334	L178H	probably damaging	Het
Galnt18	C	T	7: 111,554,616	R267H	probably damaging	Het
Gm1110	T	C	9: 26,920,696	D53G	probably benign	Het
Gm12666	T	C	4: 92,191,323	E87G	probably benign	Het
Gm5294	A	G	5: 138,820,185	S36G	probably null	Het
Gm7104	A	T	12: 88,285,472		noncoding transcript	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Haus6	C	A	4: 86,585,885	E501*	probably null	Het
Ifna5	T	C	4: 88,835,910	V129A	probably benign	Het
Kdelr3	A	G	15: 79,522,831	I38V	probably benign	Het
Lamb1	A	G	12: 31,269,055		probably null	Het
Mgat4c	T	A	10: 102,378,262	F35L	probably benign	Het
Mmab	A	T	5: 114,433,317	M166K	probably benign	Het
Mrpl2	A	G	17: 46,647,501	T70A	probably benign	Het
Naa11	C	T	5: 97,391,759	G180D	probably benign	Het
Npy6r	T	C	18: 44,275,821	V103A	possibly damaging	Het
Nup188	A	T	2: 30,341,782	R1463W	possibly damaging	Het
Nusap1	T	A	2: 119,643,830	S336R	possibly damaging	Het
Olfr876	T	A	9: 37,804,213	F101I	probably damaging	Het
Pabpc4	T	A	4: 123,297,951	L589Q	probably damaging	Het
Perm1	T	C	4: 156,217,118	S40P	probably damaging	Het
Phldb1	T	C	9: 44,726,025	T114A	probably damaging	Het
Pirt	C	T	11: 66,926,159	L99F	probably damaging	Het
Plxdc2	A	G	2: 16,712,184	R360G	probably benign	Het
Rhpn2	G	A	7: 35,381,532		probably null	Het
Rpusd2	T	A	2: 119,037,075	I268N	probably damaging	Het
Sds	G	T	5: 120,481,581	W185L	probably damaging	Het
Serpinb5	A	G	1: 106,875,146	K137R	probably benign	Het
Sh3pxd2a	A	G	19: 47,424,569	V25A	possibly damaging	Het
Slc1a2	C	T	2: 102,767,010	T454I	probably damaging	Het
Slc25a40	T	C	5: 8,430,459	C70R	probably damaging	Het
Smoc1	G	A	12: 81,167,590	E260K	probably damaging	Het
Sparcl1	A	T	5: 104,085,088	F616I	probably damaging	Het
Ssc5d	A	T	7: 4,936,335	D590V	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpm2	C	T	10: 77,941,174	V430M	probably damaging	Het
Ttn	T	C	2: 76,744,328	D25407G	probably damaging	Het
Vmn2r68	T	C	7: 85,234,595	I101V	probably benign	Het
Xrcc4	A	T	13: 90,062,142	M61K	probably damaging	Het
Zfp648	A	G	1: 154,204,949	T285A	probably damaging	Het

Other mutations in Pcdh12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcdh12	APN	18	38281457	missense	probably benign
IGL00964:Pcdh12	APN	18	38282731	missense	probably benign	0.27
IGL01105:Pcdh12	APN	18	38275347	missense	probably damaging	1.00
IGL02011:Pcdh12	APN	18	38281420	missense	probably damaging	1.00
IGL02234:Pcdh12	APN	18	38283535	missense	probably damaging	1.00
IGL02452:Pcdh12	APN	18	38281693	missense	probably benign	0.00
IGL03412:Pcdh12	APN	18	38283515	missense	probably benign	0.24
R0729:Pcdh12	UTSW	18	38282464	missense	probably benign	0.20
R1330:Pcdh12	UTSW	18	38281861	missense	probably benign	0.13
R1394:Pcdh12	UTSW	18	38281189	critical splice donor site	probably null
R1413:Pcdh12	UTSW	18	38283443	missense	probably damaging	1.00
R1993:Pcdh12	UTSW	18	38282143	missense	possibly damaging	0.62
R2115:Pcdh12	UTSW	18	38283986	missense	probably damaging	1.00
R2926:Pcdh12	UTSW	18	38282390	missense	probably damaging	0.99
R3810:Pcdh12	UTSW	18	38281237	missense	probably damaging	1.00
R3813:Pcdh12	UTSW	18	38283614	nonsense	probably null
R5275:Pcdh12	UTSW	18	38284101	utr 5 prime	probably benign
R5400:Pcdh12	UTSW	18	38268898	missense	probably damaging	1.00
R5523:Pcdh12	UTSW	18	38283139	missense	probably damaging	1.00
R5539:Pcdh12	UTSW	18	38281744	missense	possibly damaging	0.77
R5604:Pcdh12	UTSW	18	38268882	missense	probably damaging	1.00
R6012:Pcdh12	UTSW	18	38283752	missense	probably damaging	1.00
R6042:Pcdh12	UTSW	18	38281505	missense	probably damaging	1.00
R6129:Pcdh12	UTSW	18	38277859	missense	probably damaging	1.00
R6239:Pcdh12	UTSW	18	38282401	missense	probably damaging	1.00
R6508:Pcdh12	UTSW	18	38281337	nonsense	probably null
R7250:Pcdh12	UTSW	18	38281976	missense	probably benign
R7259:Pcdh12	UTSW	18	38281624	missense	probably benign	0.00
R7271:Pcdh12	UTSW	18	38283047	missense	probably damaging	1.00
R7489:Pcdh12	UTSW	18	38281789	missense	possibly damaging	0.77
R8103:Pcdh12	UTSW	18	38282159	missense	probably damaging	1.00
R8157:Pcdh12	UTSW	18	38282797	missense	probably benign
R8322:Pcdh12	UTSW	18	38281577	nonsense	probably null
R8503:Pcdh12	UTSW	18	38282521	missense	possibly damaging	0.86
R8510:Pcdh12	UTSW	18	38282056	missense	possibly damaging	0.89
Z1177:Pcdh12	UTSW	18	38282992	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAGATGGCCAGCAGTACAGC -3'
(R):5'- GAATCCCAGTGGCATGGATC -3'

Sequencing Primer
(F):5'- GCAGTACAGCCAGGCAGATC -3'
(R):5'- TGGCATGGATCCAGCAGGTAC -3'

Posted On

2014-12-04