Incidental Mutation 'R0317:Gadd45gip1'
ID25460
Institutional Source Beutler Lab
Gene Symbol Gadd45gip1
Ensembl Gene ENSMUSG00000033751
Gene Namegrowth arrest and DNA-damage-inducible, gamma interacting protein 1
SynonymsCrif1, 2310040G17Rik
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84831522-84835482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84834116 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 120 (R120H)
Ref Sequence ENSEMBL: ENSMUSP00000037783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003911] [ENSMUST00000036734] [ENSMUST00000109761] [ENSMUST00000128035]
Predicted Effect probably benign
Transcript: ENSMUST00000003911
SMART Domains Protein: ENSMUSP00000003911
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 229 272 5.7e-8 SMART
low complexity region 296 307 N/A INTRINSIC
UBA 319 356 9.11e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036734
AA Change: R120H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037783
Gene: ENSMUSG00000033751
AA Change: R120H

DomainStartEndE-ValueType
Pfam:CR6_interact 1 211 1.5e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109761
SMART Domains Protein: ENSMUSP00000105383
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 230 273 5.7e-8 SMART
low complexity region 297 308 N/A INTRINSIC
UBA 320 357 9.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125711
Predicted Effect probably benign
Transcript: ENSMUST00000128035
SMART Domains Protein: ENSMUSP00000115664
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 230 273 5.7e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134395
Predicted Effect probably benign
Transcript: ENSMUST00000144675
SMART Domains Protein: ENSMUSP00000114431
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
SCOP:d1ifya_ 2 18 3e-3 SMART
STI1 44 87 5.7e-8 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144994
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized protein that may be induced by p53 and regulates the cell cycle by inhibiting G1 to S phase progression. The encoded protein may interact with other cell cycle regulators. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before somite formation with decreased cell proliferation, increased apoptisis, and failure of inner cell mass outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Gadd45gip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0357:Gadd45gip1 UTSW 8 84834133 missense probably damaging 1.00
R1739:Gadd45gip1 UTSW 8 84832292 start codon destroyed probably null 0.71
R7685:Gadd45gip1 UTSW 8 84832351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCAGACATTTGGATCGCCCC -3'
(R):5'- AGCAGCAATTCGTGCCTCCTTC -3'

Sequencing Primer
(F):5'- agatgaccctttttacagatgaaac -3'
(R):5'- CCTGTAATAGTTCCTGGAAGCGAG -3'
Posted On2013-04-16