Incidental Mutation 'R2568:Axdnd1'
ID254601
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Nameaxonemal dynein light chain domain containing 1
SynonymsLOC381304, 9430070O13Rik
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location156323509-156421159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156392749 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 234 (M234L)
Ref Sequence ENSEMBL: ENSMUSP00000135900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027895
Predicted Effect possibly damaging
Transcript: ENSMUST00000177824
AA Change: M234L

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: M234L

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178036
AA Change: M299L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: M299L

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000180173
AA Change: M136L
Predicted Effect probably benign
Transcript: ENSMUST00000213088
AA Change: M299L

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156380886 missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156365689 missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156392003 missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156365651 missense probably benign 0.02
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 splice site probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
R7882:Axdnd1 UTSW 1 156397453 missense
R8256:Axdnd1 UTSW 1 156330666 missense unknown
R8348:Axdnd1 UTSW 1 156418284 missense probably benign 0.02
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156349063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTTAGCATTTCCTACAGGTAAAG -3'
(R):5'- TGTGGTTCCTCTCAAAAGGG -3'

Sequencing Primer
(F):5'- TAAAGACAAGGCTCTGGCTTC -3'
(R):5'- GACACGTCTTGTCTTTGGT -3'
Posted On2014-12-04