Incidental Mutation 'R2568:Olfr341'
ID254603
Institutional Source Beutler Lab
Gene Symbol Olfr341
Ensembl Gene ENSMUSG00000075387
Gene Nameolfactory receptor 341
SynonymsGA_x6K02T2NLDC-33174915-33173974, MOR136-2
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36473721-36482468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36479974 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000150801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100154] [ENSMUST00000213300]
Predicted Effect probably damaging
Transcript: ENSMUST00000100154
AA Change: D52G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097731
Gene: ENSMUSG00000075387
AA Change: D52G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4e-6 PFAM
Pfam:7tm_1 41 290 9.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213300
AA Change: D52G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Olfr341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Olfr341 APN 2 36479356 missense probably damaging 1.00
IGL01469:Olfr341 APN 2 36479824 missense probably benign 0.44
IGL02269:Olfr341 APN 2 36479567 missense possibly damaging 0.86
IGL02870:Olfr341 APN 2 36480031 missense probably benign
IGL03190:Olfr341 APN 2 36479722 missense probably damaging 1.00
R0988:Olfr341 UTSW 2 36479767 missense probably damaging 1.00
R1214:Olfr341 UTSW 2 36479969 missense possibly damaging 0.67
R1785:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R1786:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2130:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2131:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2132:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2133:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R4115:Olfr341 UTSW 2 36479785 missense probably damaging 1.00
R4384:Olfr341 UTSW 2 36479998 missense probably damaging 1.00
R4721:Olfr341 UTSW 2 36479824 missense probably benign 0.44
R5375:Olfr341 UTSW 2 36479297 missense probably damaging 0.98
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6084:Olfr341 UTSW 2 36479512 missense probably benign 0.01
R6340:Olfr341 UTSW 2 36480020 missense probably benign 0.31
R7238:Olfr341 UTSW 2 36479714 missense possibly damaging 0.54
R7532:Olfr341 UTSW 2 36480126 start codon destroyed probably null 0.27
Predicted Primers PCR Primer
(F):5'- ATGGCCACATACCTGTCATAG -3'
(R):5'- TTTCACTCACAGCAGAAGAGG -3'

Sequencing Primer
(F):5'- CTGTCATAGGCCATGGAGGTC -3'
(R):5'- TTCACTCACAGCAGAAGAGGAAGAAC -3'
Posted On2014-12-04