Mutagenetix > Incidental Mutations

Incidental Mutation 'R2568:Sirpa'

254609

Institutional Source

Beutler Lab

Gene Symbol

Sirpa

Ensembl Gene

ENSMUSG00000037902

Gene Name

signal-regulatory protein alpha

Synonyms

SIRP, Ptpns1, CD172a, P84, SHPS-1, Bit

MMRRC Submission

040427-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129592835-129632228 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129615648 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 214 (V214A)

Ref Sequence

ENSEMBL: ENSMUSP00000137611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049262] [ENSMUST00000099113] [ENSMUST00000103202] [ENSMUST00000103203] [ENSMUST00000153491] [ENSMUST00000160276] [ENSMUST00000161620] [ENSMUST00000163034] [ENSMUST00000179001]

Predicted Effect

probably benign
Transcript: ENSMUST00000049262
AA Change: V214A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000049022
Gene: ENSMUSG00000037902
AA Change: V214A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	446	458	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099113

SMART Domains

Protein: ENSMUSP00000096713
Gene: ENSMUSG00000037902

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
transmembrane domain	156	178	N/A	INTRINSIC
low complexity region	228	240	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103202
AA Change: V214A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000099491
Gene: ENSMUSG00000037902
AA Change: V214A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103203
AA Change: V214A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000099492
Gene: ENSMUSG00000037902
AA Change: V214A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153491

SMART Domains

Protein: ENSMUSP00000120324
Gene: ENSMUSG00000037902

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160276

SMART Domains

Protein: ENSMUSP00000125004
Gene: ENSMUSG00000037902

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
transmembrane domain	156	178	N/A	INTRINSIC
low complexity region	224	236	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160952

Predicted Effect

probably benign
Transcript: ENSMUST00000161620
AA Change: V214A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000124048
Gene: ENSMUSG00000037902
AA Change: V214A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	446	458	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163034

SMART Domains

Protein: ENSMUSP00000124888
Gene: ENSMUSG00000037902

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
low complexity region	105	117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179001
AA Change: V214A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000137611
Gene: ENSMUSG00000037902
AA Change: V214A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
IG	40	146	1.78e-9	SMART
IGc1	166	239	5.4e-4	SMART
IGc1	269	342	8.51e-7	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display mild thrombocytopenia, fatty livers, decreased body weight, decreased proportion of single positive T cells, enhanced peritoneal macrophage phagocytosis and impaired Langerhans cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,201,269	V1010A	possibly damaging	Het
4930563D23Rik	A	G	16: 92,321,319	L27P	probably damaging	Het
A730071L15Rik	A	T	11: 6,200,161		probably benign	Het
Abca13	A	T	11: 9,333,310	N3244I	probably benign	Het
Adgrf5	A	G	17: 43,437,671	T219A	probably damaging	Het
Adgrg5	A	T	8: 94,934,021	N92I	probably damaging	Het
Agt	A	C	8: 124,556,955	V475G	probably damaging	Het
Akap6	A	G	12: 52,887,278	K518E	possibly damaging	Het
Apoh	T	G	11: 108,404,871	D133E	probably benign	Het
Axdnd1	T	A	1: 156,392,749	M234L	possibly damaging	Het
Cacna1d	A	G	14: 30,082,511	I1335T	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cfap206	T	A	4: 34,711,566	K444*	probably null	Het
Clasp2	A	G	9: 113,878,764	I614M	probably benign	Het
Col6a4	A	T	9: 106,063,076	D1218E	possibly damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
D130043K22Rik	C	T	13: 24,883,891	T870M	probably damaging	Het
Dagla	C	A	19: 10,248,152	A883S	probably benign	Het
Dhx30	A	G	9: 110,097,195	V87A	probably damaging	Het
Dtx1	C	A	5: 120,710,184	V44L	possibly damaging	Het
Ecm2	T	A	13: 49,530,129	S528T	possibly damaging	Het
Egfem1	A	T	3: 29,582,931	N172I	probably damaging	Het
Fam102b	T	A	3: 108,978,848	N356I	probably benign	Het
Fam13a	T	G	6: 58,935,609	R686S	probably damaging	Het
Fmo1	T	A	1: 162,836,259	I234L	probably benign	Het
Foxj2	C	T	6: 122,828,372	R68W	probably damaging	Het
Foxo6	A	T	4: 120,268,764	M278K	probably benign	Het
Fsip2	A	G	2: 82,990,431	S5503G	probably benign	Het
Gdf5	C	G	2: 155,942,090	R100G	probably benign	Het
Il1b	A	T	2: 129,367,322	D129E	probably damaging	Het
Klhl29	A	G	12: 5,091,350	S545P	probably damaging	Het
Krt83	G	T	15: 101,487,827	R296S	possibly damaging	Het
Llgl1	T	G	11: 60,708,812	S509R	probably damaging	Het
Lmod1	A	T	1: 135,363,964	K186*	probably null	Het
Lrpprc	C	T	17: 84,726,649	A973T	probably damaging	Het
Marco	T	C	1: 120,494,785	H49R	possibly damaging	Het
Mylk4	T	C	13: 32,722,018	N394S	probably null	Het
Myo5a	A	G	9: 75,123,040	Y147C	probably damaging	Het
Myo5a	T	C	9: 75,151,897	V469A	probably damaging	Het
Myot	A	G	18: 44,337,216	T87A	probably benign	Het
Nav2	A	G	7: 49,597,564	H2154R	probably damaging	Het
Nek10	A	G	14: 14,999,112	E1037G	possibly damaging	Het
Olfr181	A	G	16: 58,925,923	V216A	probably benign	Het
Olfr341	T	C	2: 36,479,974	D52G	probably damaging	Het
Olfr677	A	G	7: 105,056,671	T142A	probably benign	Het
Pitrm1	G	T	13: 6,575,092	V869F	probably benign	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Prdx1	T	G	4: 116,693,800	I156S	probably benign	Het
Rbks	T	A	5: 31,665,752	T107S	probably damaging	Het
Ryr3	G	A	2: 112,675,874	R3468W	probably damaging	Het
Scn1a	C	T	2: 66,273,469	D1805N	probably damaging	Het
Slc35c1	T	C	2: 92,458,880	N94D	probably benign	Het
Sorbs2	A	T	8: 45,795,370	K553*	probably null	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Thg1l	A	G	11: 45,951,565	V142A	probably benign	Het
Tiparp	T	A	3: 65,553,130	Y513*	probably null	Het
Tmc6	A	G	11: 117,772,820	V522A	probably benign	Het
Trim39	T	A	17: 36,269,164		probably benign	Het
Trrap	G	A	5: 144,843,369		probably null	Het
Tulp3	C	T	6: 128,327,638	V218I	probably benign	Het
Vmn1r38	T	A	6: 66,776,971	I54F	probably benign	Het
Vmn2r23	T	A	6: 123,742,188	Y833*	probably null	Het
Zfp810	A	T	9: 22,279,238	S125T	probably benign	Het

Other mutations in Sirpa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Sirpa	APN	2	129609183	missense	probably damaging	1.00
IGL01138:Sirpa	APN	2	129630165	missense	probably damaging	1.00
IGL01835:Sirpa	APN	2	129615564	missense	possibly damaging	0.76
IGL02558:Sirpa	APN	2	129630069	missense	probably damaging	1.00
IGL02825:Sirpa	APN	2	129615452	missense	probably damaging	0.99
IGL03083:Sirpa	APN	2	129629928	missense	probably damaging	1.00
R0234:Sirpa	UTSW	2	129615468	missense	probably damaging	0.99
R0234:Sirpa	UTSW	2	129615468	missense	probably damaging	0.99
R0831:Sirpa	UTSW	2	129627936	splice site	probably benign
R1550:Sirpa	UTSW	2	129630041	missense	probably damaging	1.00
R1772:Sirpa	UTSW	2	129616456	missense	probably damaging	0.99
R1806:Sirpa	UTSW	2	129615512	missense	probably damaging	1.00
R1927:Sirpa	UTSW	2	129616376	missense	possibly damaging	0.46
R4849:Sirpa	UTSW	2	129609243	missense	probably damaging	1.00
R5182:Sirpa	UTSW	2	129615732	missense	possibly damaging	0.65
R5673:Sirpa	UTSW	2	129630102	missense	probably damaging	1.00
R5680:Sirpa	UTSW	2	129616252	missense	probably benign	0.02
R6521:Sirpa	UTSW	2	129630155	missense	probably damaging	1.00
R6821:Sirpa	UTSW	2	129630097	missense	probably damaging	1.00
R7602:Sirpa	UTSW	2	129609152	missense	probably damaging	1.00
R7637:Sirpa	UTSW	2	129616445	missense	probably benign	0.44
R8311:Sirpa	UTSW	2	129616223	missense	probably damaging	1.00
RF018:Sirpa	UTSW	2	129609203	nonsense	probably null
RF049:Sirpa	UTSW	2	129609203	nonsense	probably null
Z1088:Sirpa	UTSW	2	129618535	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTTGCTTGGCCATCACAATC -3'
(R):5'- TCATAGGGTAATGGCTGCTG -3'

Sequencing Primer
(F):5'- GCTTGGCCATCACAATCATATTTC -3'
(R):5'- CATAGGGTAATGGCTGCTGTGAAC -3'

Posted On

2014-12-04