Incidental Mutation 'R0317:Rbl2'
ID25461
Institutional Source Beutler Lab
Gene Symbol Rbl2
Ensembl Gene ENSMUSG00000031666
Gene NameRB transcriptional corepressor like 2
Synonymsp130, Rb2
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location91070057-91123844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91087144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 339 (D339G)
Ref Sequence ENSEMBL: ENSMUSP00000147579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000209518] [ENSMUST00000211136]
Predicted Effect probably benign
Transcript: ENSMUST00000034091
AA Change: D382G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666
AA Change: D382G

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209518
AA Change: D382G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211136
AA Change: D339G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice generally show no overt phenotype. Homozygotes for a null allele show strain-dependent embryonic lethality and growth arrest associated with altered apoptosis and cell proliferation, impaired neurogenesis and myogenesis, failed embryo turning and heart looping, and thin myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Rbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rbl2 APN 8 91085445 missense probably damaging 1.00
IGL01084:Rbl2 APN 8 91122313 missense probably damaging 0.99
IGL01317:Rbl2 APN 8 91100057 missense probably damaging 1.00
IGL01637:Rbl2 APN 8 91106438 missense probably benign
IGL01843:Rbl2 APN 8 91090216 missense probably benign 0.11
IGL01884:Rbl2 APN 8 91096836 missense probably damaging 1.00
IGL02071:Rbl2 APN 8 91102198 missense probably damaging 1.00
IGL02588:Rbl2 APN 8 91087084 missense probably damaging 0.99
IGL03027:Rbl2 APN 8 91078906 missense possibly damaging 0.92
IGL03162:Rbl2 APN 8 91085702 missense probably benign 0.01
IGL03200:Rbl2 APN 8 91096767 missense probably benign 0.00
R0165:Rbl2 UTSW 8 91074176 missense probably damaging 1.00
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0539:Rbl2 UTSW 8 91112505 splice site probably benign
R1532:Rbl2 UTSW 8 91106417 missense probably benign 0.01
R1696:Rbl2 UTSW 8 91085724 missense probably benign 0.12
R1852:Rbl2 UTSW 8 91095563 missense possibly damaging 0.84
R1866:Rbl2 UTSW 8 91112529 missense probably benign 0.00
R1975:Rbl2 UTSW 8 91085462 missense probably benign
R2062:Rbl2 UTSW 8 91106739 missense probably damaging 1.00
R2180:Rbl2 UTSW 8 91090055 missense possibly damaging 0.51
R2423:Rbl2 UTSW 8 91087146 missense probably benign 0.34
R3109:Rbl2 UTSW 8 91102235 missense probably benign
R4356:Rbl2 UTSW 8 91107107 missense probably damaging 0.97
R4692:Rbl2 UTSW 8 91122419 missense probably damaging 1.00
R4707:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R4784:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R5084:Rbl2 UTSW 8 91115131 missense probably benign 0.43
R5432:Rbl2 UTSW 8 91102283 missense probably benign 0.01
R5493:Rbl2 UTSW 8 91115819 missense probably damaging 1.00
R5546:Rbl2 UTSW 8 91078932 missense probably benign 0.00
R5918:Rbl2 UTSW 8 91090130 missense probably benign 0.02
R6186:Rbl2 UTSW 8 91106730 missense probably damaging 1.00
R6257:Rbl2 UTSW 8 91115678 missense probably damaging 1.00
R6526:Rbl2 UTSW 8 91096839 missense probably benign 0.04
R6546:Rbl2 UTSW 8 91070370 missense probably benign
R6714:Rbl2 UTSW 8 91106787 missense possibly damaging 0.91
R7214:Rbl2 UTSW 8 91083429 critical splice donor site probably null
R7286:Rbl2 UTSW 8 91102294 nonsense probably null
R7290:Rbl2 UTSW 8 91115041 missense probably benign 0.33
R7315:Rbl2 UTSW 8 91076012 missense probably damaging 0.96
R7524:Rbl2 UTSW 8 91115193 missense probably benign
X0023:Rbl2 UTSW 8 91090079 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCGGTCCTGTTTCCCCATAGTAAG -3'
(R):5'- CAAGTGTCTCTGTGACCACTGTGC -3'

Sequencing Primer
(F):5'- TCCCCATAGTAAGGCCGTTAATAAG -3'
(R):5'- AAacacacacacacacacacac -3'
Posted On2013-04-16