Incidental Mutation 'R2568:Gdf5'
ID 254610
Institutional Source Beutler Lab
Gene Symbol Gdf5
Ensembl Gene ENSMUSG00000038259
Gene Name growth differentiation factor 5
Synonyms cartilage-derived morphogenetic protein-1, brp, bp, CDMP-1
MMRRC Submission 040427-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.372) question?
Stock # R2568 (G1)
Quality Score 84
Status Not validated
Chromosome 2
Chromosomal Location 155941023-155945367 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 155942090 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 100 (R100G)
Ref Sequence ENSEMBL: ENSMUSP00000105257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040162] [ENSMUST00000109629]
AlphaFold P43027
Predicted Effect probably benign
Transcript: ENSMUST00000040162
AA Change: R314P

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048079
Gene: ENSMUSG00000038259
AA Change: R314P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:TGFb_propeptide 133 343 2.4e-16 PFAM
TGFB 394 495 8.92e-66 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109629
AA Change: R100G

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105257
Gene: ENSMUSG00000078972
AA Change: R100G

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 89 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates the development of numerous tissue and cell types, including cartilage, joints, brown fat, teeth, and the growth of neuronal axons and dendrites. Mice with a mutation in this gene exhibit enhanced tooth enamel formation. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutations in this gene can cause joint patterning defects leading to complete or partial fusions between specific skeletal elements and alterations in the patterns of repeating structures in the digits, wrists and ankles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Gdf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Gdf5 APN 2 155941706 missense probably damaging 1.00
R1900:Gdf5 UTSW 2 155942081 missense probably damaging 1.00
R1962:Gdf5 UTSW 2 155941752 missense probably damaging 1.00
R4556:Gdf5 UTSW 2 155941862 missense probably benign
R7038:Gdf5 UTSW 2 155944735 missense probably damaging 0.99
R7990:Gdf5 UTSW 2 155941829 missense probably damaging 1.00
R8406:Gdf5 UTSW 2 155942352 missense probably damaging 1.00
R9282:Gdf5 UTSW 2 155941995 missense probably damaging 1.00
Z1177:Gdf5 UTSW 2 155942072 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CCGCTGGCTGAACAAATATTC -3'
(R):5'- TTACGGAAGAAGCCCTTGG -3'

Sequencing Primer
(F):5'- GCTGGCTGAACAAATATTCATACAC -3'
(R):5'- GTTGCCCAACTGAAGCTGTC -3'
Posted On 2014-12-04