Incidental Mutation 'R2568:Egfem1'
ID254611
Institutional Source Beutler Lab
Gene Symbol Egfem1
Ensembl Gene ENSMUSG00000063600
Gene NameEGF-like and EMI domain containing 1
Synonyms6130401L20Rik
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location29082023-29691209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29582931 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 172 (N172I)
Ref Sequence ENSEMBL: ENSMUSP00000112943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118531] [ENSMUST00000119598] [ENSMUST00000146943]
Predicted Effect probably benign
Transcript: ENSMUST00000118531
AA Change: N196I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112907
Gene: ENSMUSG00000063600
AA Change: N196I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 30 104 1.4e-15 PFAM
Blast:EGF_like 108 145 7e-10 BLAST
EGF 150 187 2.16e1 SMART
EGF_CA 188 228 2.66e-10 SMART
EGF 237 274 1.08e-1 SMART
EGF_like 275 313 9.19e-5 SMART
low complexity region 317 331 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
EGF 391 424 1.09e1 SMART
Blast:EGF_like 449 481 5e-10 BLAST
EGF 492 526 2.43e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119598
AA Change: N172I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112943
Gene: ENSMUSG00000063600
AA Change: N172I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 31 102 1.1e-15 PFAM
Blast:EGF_like 108 145 6e-10 BLAST
EGF_CA 164 204 1.61e-9 SMART
EGF 208 244 6.4e-4 SMART
EGF_CA 245 285 1.81e-12 SMART
EGF 294 331 1.08e-1 SMART
EGF_like 332 370 9.19e-5 SMART
low complexity region 374 388 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
EGF 448 481 1.09e1 SMART
Blast:EGF_like 506 538 5e-10 BLAST
EGF 549 583 2.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126420
Predicted Effect unknown
Transcript: ENSMUST00000140288
AA Change: N43I
SMART Domains Protein: ENSMUSP00000117016
Gene: ENSMUSG00000063600
AA Change: N43I

DomainStartEndE-ValueType
EGF_like 5 35 4.32e-1 SMART
EGF_CA 36 76 2.66e-10 SMART
EGF 85 122 1.08e-1 SMART
low complexity region 124 138 N/A INTRINSIC
low complexity region 164 178 N/A INTRINSIC
EGF 198 231 1.09e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143483
SMART Domains Protein: ENSMUSP00000114146
Gene: ENSMUSG00000063600

DomainStartEndE-ValueType
EGF 22 59 2.16e1 SMART
EGF_CA 60 100 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146943
SMART Domains Protein: ENSMUSP00000118156
Gene: ENSMUSG00000063600

DomainStartEndE-ValueType
Pfam:EMI 17 91 1.8e-16 PFAM
Blast:EGF_like 95 132 2e-11 BLAST
EGF 137 174 2.16e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Egfem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Egfem1 APN 3 29657153 missense possibly damaging 0.54
IGL02111:Egfem1 APN 3 29650896 splice site probably null
IGL02325:Egfem1 APN 3 29151917 missense probably benign 0.01
IGL02450:Egfem1 APN 3 29657268 critical splice donor site probably null
IGL02543:Egfem1 APN 3 29668380 missense probably benign 0.01
IGL02835:Egfem1 UTSW 3 29657241 missense probably damaging 1.00
P0033:Egfem1 UTSW 3 29690191 missense probably damaging 1.00
R0010:Egfem1 UTSW 3 29582919 missense probably damaging 1.00
R0294:Egfem1 UTSW 3 29690121 missense probably damaging 1.00
R0379:Egfem1 UTSW 3 29668250 missense possibly damaging 0.92
R1479:Egfem1 UTSW 3 29657165 missense probably damaging 1.00
R1572:Egfem1 UTSW 3 29648271 missense probably benign 0.02
R1754:Egfem1 UTSW 3 29668333 missense possibly damaging 0.68
R2679:Egfem1 UTSW 3 29670676 missense probably benign 0.01
R3411:Egfem1 UTSW 3 29583021 missense probably damaging 1.00
R3801:Egfem1 UTSW 3 29151926 missense probably benign 0.14
R4049:Egfem1 UTSW 3 29686731 missense probably benign 0.01
R4851:Egfem1 UTSW 3 29151883 missense possibly damaging 0.92
R4917:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4918:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4969:Egfem1 UTSW 3 29582996 missense probably damaging 0.98
R4997:Egfem1 UTSW 3 29153590 missense probably benign 0.00
R5148:Egfem1 UTSW 3 29457823 intron probably benign
R5194:Egfem1 UTSW 3 29357196 critical splice donor site probably null
R5284:Egfem1 UTSW 3 29650787 missense possibly damaging 0.53
R5354:Egfem1 UTSW 3 29082212 critical splice donor site probably null
R5627:Egfem1 UTSW 3 29668399 nonsense probably null
R5677:Egfem1 UTSW 3 29690174 missense probably damaging 0.99
R5928:Egfem1 UTSW 3 29582928 missense possibly damaging 0.92
R5982:Egfem1 UTSW 3 29657270 splice site probably null
R6419:Egfem1 UTSW 3 29657249 missense probably damaging 1.00
R6475:Egfem1 UTSW 3 29657163 missense probably damaging 1.00
R6586:Egfem1 UTSW 3 29662411 nonsense probably null
R7046:Egfem1 UTSW 3 29082215 splice site probably null
R7079:Egfem1 UTSW 3 29153582 missense probably benign 0.00
R7308:Egfem1 UTSW 3 29151866 missense probably benign 0.09
R7362:Egfem1 UTSW 3 29151920 missense probably benign 0.01
R7684:Egfem1 UTSW 3 29690185 missense probably damaging 0.97
R7697:Egfem1 UTSW 3 29690197 critical splice donor site probably null
R7814:Egfem1 UTSW 3 29686791 missense probably damaging 1.00
X0028:Egfem1 UTSW 3 29657146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTTGCTGTTCAAACCAC -3'
(R):5'- GGAATTGAACTCAAATACCATCAGC -3'

Sequencing Primer
(F):5'- CTTGTTTACATAGTGGAGCAAAACG -3'
(R):5'- AGAAATCTTTCTCCTCAGCCC -3'
Posted On2014-12-04