Incidental Mutation 'R2568:Cfap206'
ID254615
Institutional Source Beutler Lab
Gene Symbol Cfap206
Ensembl Gene ENSMUSG00000028294
Gene Namecilia and flagella associated protein 206
Synonyms1700003M02Rik
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location34688559-34730206 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34711566 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 444 (K444*)
Ref Sequence ENSEMBL: ENSMUSP00000103771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029971] [ENSMUST00000108136]
Predicted Effect probably null
Transcript: ENSMUST00000029971
AA Change: K444*
SMART Domains Protein: ENSMUSP00000029971
Gene: ENSMUSG00000028294
AA Change: K444*

DomainStartEndE-ValueType
Pfam:DUF3508 214 491 6.1e-108 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108136
AA Change: K444*
SMART Domains Protein: ENSMUSP00000103771
Gene: ENSMUSG00000028294
AA Change: K444*

DomainStartEndE-ValueType
Pfam:DUF3508 213 493 3.8e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135563
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Cfap206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00798:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00826:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00919:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01062:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01064:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01069:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01070:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01086:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01087:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01090:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01098:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01111:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01133:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01135:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01147:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01152:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01153:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01154:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01155:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01289:Cfap206 APN 4 34716469 missense probably null 0.98
IGL01845:Cfap206 APN 4 34719610 missense possibly damaging 0.57
IGL02115:Cfap206 APN 4 34722623 missense possibly damaging 0.54
IGL03241:Cfap206 APN 4 34711553 missense probably damaging 1.00
IGL03405:Cfap206 APN 4 34716445 missense possibly damaging 0.82
ANU05:Cfap206 UTSW 4 34721562 missense probably damaging 1.00
R0012:Cfap206 UTSW 4 34714519 missense possibly damaging 0.76
R0689:Cfap206 UTSW 4 34722668 missense probably benign 0.23
R0730:Cfap206 UTSW 4 34711391 missense probably benign
R1567:Cfap206 UTSW 4 34716490 missense probably benign 0.01
R1694:Cfap206 UTSW 4 34719058 missense probably damaging 1.00
R1706:Cfap206 UTSW 4 34688875 missense probably damaging 1.00
R1837:Cfap206 UTSW 4 34728813 missense probably damaging 1.00
R1909:Cfap206 UTSW 4 34722714 missense probably benign
R2098:Cfap206 UTSW 4 34719053 nonsense probably null
R3125:Cfap206 UTSW 4 34716310 missense possibly damaging 0.48
R3784:Cfap206 UTSW 4 34716445 missense probably damaging 0.99
R5249:Cfap206 UTSW 4 34714502 missense probably benign
R5483:Cfap206 UTSW 4 34711404 missense probably benign 0.39
R5569:Cfap206 UTSW 4 34724892 missense probably damaging 1.00
R6247:Cfap206 UTSW 4 34692530 missense probably benign
R6555:Cfap206 UTSW 4 34719049 missense probably damaging 1.00
R6791:Cfap206 UTSW 4 34711414 missense possibly damaging 0.76
R6865:Cfap206 UTSW 4 34714448 missense possibly damaging 0.57
R7164:Cfap206 UTSW 4 34719656 missense probably benign
R7814:Cfap206 UTSW 4 34716347 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGAGAATGCCATGTTTACCTG -3'
(R):5'- TGTGGCTTAATGGGTAAGAAGC -3'

Sequencing Primer
(F):5'- ATGCCATGTTTACCTGAGAATAGGG -3'
(R):5'- ACAGTCCTATAGCCTTTGCATAGGG -3'
Posted On2014-12-04