Incidental Mutation 'R2568:Prdx1'
ID 254616
Institutional Source Beutler Lab
Gene Symbol Prdx1
Ensembl Gene ENSMUSG00000028691
Gene Name peroxiredoxin 1
Synonyms Paga, Trx dependent peroxide reductase 2, osteoblast specific factor 3, Prx I, macrophase stress protein 22kDa, macrophage 23kDa stress protein, PAG, Tdpx2, PrxI, thioredoxin dependent peroxide reductase 2, TDX2, OSF-3, MSP23, prx1
MMRRC Submission 040427-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.694) question?
Stock # R2568 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 116542796-116557196 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 116550997 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 156 (I156S)
Ref Sequence ENSEMBL: ENSMUSP00000119794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030454] [ENSMUST00000106470] [ENSMUST00000129315] [ENSMUST00000135573] [ENSMUST00000151129]
AlphaFold P35700
Predicted Effect probably benign
Transcript: ENSMUST00000030454
AA Change: I156S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030454
Gene: ENSMUSG00000028691
AA Change: I156S

DomainStartEndE-ValueType
Pfam:Redoxin 7 158 1.1e-18 PFAM
Pfam:AhpC-TSA 8 142 9e-44 PFAM
Pfam:1-cysPrx_C 162 176 8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106470
AA Change: I156S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102078
Gene: ENSMUSG00000028691
AA Change: I156S

DomainStartEndE-ValueType
Pfam:Redoxin 7 157 2.7e-17 PFAM
Pfam:AhpC-TSA 8 142 6.1e-42 PFAM
Pfam:1-cysPrx_C 162 197 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129315
SMART Domains Protein: ENSMUSP00000117007
Gene: ENSMUSG00000028691

DomainStartEndE-ValueType
Pfam:Redoxin 7 123 3.3e-14 PFAM
Pfam:AhpC-TSA 8 123 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135573
AA Change: I156S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114159
Gene: ENSMUSG00000028691
AA Change: I156S

DomainStartEndE-ValueType
Pfam:Redoxin 7 158 3.8e-18 PFAM
Pfam:AhpC-TSA 8 142 2.8e-43 PFAM
Pfam:1-cysPrx_C 162 197 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151129
AA Change: I156S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119794
Gene: ENSMUSG00000028691
AA Change: I156S

DomainStartEndE-ValueType
Pfam:Redoxin 7 158 9.8e-19 PFAM
Pfam:AhpC-TSA 8 142 8e-44 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in cells, and may contribute to the antiviral activity of CD8(+) T-cells. This protein may have a proliferative effect and play a role in cancer development or progression. Four transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mutant mice exhibit defects in antioxidant defense that manifest as hemolytic anemia and malignancies. The phenotype is more severe in homozygous mutant mice which die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,150,161 (GRCm39) probably benign Het
Abca13 A T 11: 9,283,310 (GRCm39) N3244I probably benign Het
Adgrf5 A G 17: 43,748,562 (GRCm39) T219A probably damaging Het
Adgrg5 A T 8: 95,660,649 (GRCm39) N92I probably damaging Het
Agt A C 8: 125,283,694 (GRCm39) V475G probably damaging Het
Akap6 A G 12: 52,934,061 (GRCm39) K518E possibly damaging Het
Apoh T G 11: 108,295,697 (GRCm39) D133E probably benign Het
Axdnd1 T A 1: 156,220,319 (GRCm39) M234L possibly damaging Het
Cacna1d A G 14: 29,804,468 (GRCm39) I1335T probably damaging Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 (GRCm39) K444* probably null Het
Clasp2 A G 9: 113,707,832 (GRCm39) I614M probably benign Het
Col6a4 A T 9: 105,940,275 (GRCm39) D1218E possibly damaging Het
Cplane1 T C 15: 8,230,753 (GRCm39) V1010A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
D130043K22Rik C T 13: 25,067,874 (GRCm39) T870M probably damaging Het
Dagla C A 19: 10,225,516 (GRCm39) A883S probably benign Het
Dhx30 A G 9: 109,926,263 (GRCm39) V87A probably damaging Het
Dtx1 C A 5: 120,848,249 (GRCm39) V44L possibly damaging Het
Ecm2 T A 13: 49,683,605 (GRCm39) S528T possibly damaging Het
Eeig2 T A 3: 108,886,164 (GRCm39) N356I probably benign Het
Egfem1 A T 3: 29,637,080 (GRCm39) N172I probably damaging Het
Fam13a T G 6: 58,912,594 (GRCm39) R686S probably damaging Het
Fam243 A G 16: 92,118,207 (GRCm39) L27P probably damaging Het
Fmo1 T A 1: 162,663,828 (GRCm39) I234L probably benign Het
Foxj2 C T 6: 122,805,331 (GRCm39) R68W probably damaging Het
Foxo6 A T 4: 120,125,961 (GRCm39) M278K probably benign Het
Fsip2 A G 2: 82,820,775 (GRCm39) S5503G probably benign Het
Gdf5 C G 2: 155,784,010 (GRCm39) R100G probably benign Het
Il1b A T 2: 129,209,242 (GRCm39) D129E probably damaging Het
Klhl29 A G 12: 5,141,350 (GRCm39) S545P probably damaging Het
Krt87 G T 15: 101,385,708 (GRCm39) R296S possibly damaging Het
Llgl1 T G 11: 60,599,638 (GRCm39) S509R probably damaging Het
Lmod1 A T 1: 135,291,702 (GRCm39) K186* probably null Het
Lrpprc C T 17: 85,034,077 (GRCm39) A973T probably damaging Het
Marco T C 1: 120,422,514 (GRCm39) H49R possibly damaging Het
Mylk4 T C 13: 32,906,001 (GRCm39) N394S probably null Het
Myo5a A G 9: 75,030,322 (GRCm39) Y147C probably damaging Het
Myo5a T C 9: 75,059,179 (GRCm39) V469A probably damaging Het
Myot A G 18: 44,470,283 (GRCm39) T87A probably benign Het
Nav2 A G 7: 49,247,312 (GRCm39) H2154R probably damaging Het
Nek10 A G 14: 14,999,112 (GRCm38) E1037G possibly damaging Het
Or1j13 T C 2: 36,369,986 (GRCm39) D52G probably damaging Het
Or52e4 A G 7: 104,705,878 (GRCm39) T142A probably benign Het
Or5k17 A G 16: 58,746,286 (GRCm39) V216A probably benign Het
Pitrm1 G T 13: 6,625,128 (GRCm39) V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,976,940 (GRCm39) probably benign Het
Rbks T A 5: 31,823,096 (GRCm39) T107S probably damaging Het
Ryr3 G A 2: 112,506,219 (GRCm39) R3468W probably damaging Het
Scn1a C T 2: 66,103,813 (GRCm39) D1805N probably damaging Het
Sirpa T C 2: 129,457,568 (GRCm39) V214A probably benign Het
Slc35c1 T C 2: 92,289,225 (GRCm39) N94D probably benign Het
Sorbs2 A T 8: 46,248,407 (GRCm39) K553* probably null Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thg1l A G 11: 45,842,392 (GRCm39) V142A probably benign Het
Tiparp T A 3: 65,460,551 (GRCm39) Y513* probably null Het
Tmc6 A G 11: 117,663,646 (GRCm39) V522A probably benign Het
Trim39 T A 17: 36,580,056 (GRCm39) probably benign Het
Trrap G A 5: 144,780,179 (GRCm39) probably null Het
Tulp3 C T 6: 128,304,601 (GRCm39) V218I probably benign Het
Vmn1r38 T A 6: 66,753,955 (GRCm39) I54F probably benign Het
Vmn2r23 T A 6: 123,719,147 (GRCm39) Y833* probably null Het
Zfp810 A T 9: 22,190,534 (GRCm39) S125T probably benign Het
Other mutations in Prdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Prdx1 APN 4 116,550,147 (GRCm39) missense probably benign 0.01
IGL00654:Prdx1 APN 4 116,550,162 (GRCm39) missense probably benign 0.03
IGL00769:Prdx1 APN 4 116,550,162 (GRCm39) missense probably benign 0.03
IGL00851:Prdx1 APN 4 116,550,147 (GRCm39) missense probably benign 0.01
IGL02224:Prdx1 APN 4 116,549,064 (GRCm39) missense probably damaging 1.00
R1891:Prdx1 UTSW 4 116,556,451 (GRCm39) makesense probably null
R4495:Prdx1 UTSW 4 116,556,416 (GRCm39) missense probably benign 0.13
R4971:Prdx1 UTSW 4 116,549,128 (GRCm39) critical splice donor site probably null
R5610:Prdx1 UTSW 4 116,550,124 (GRCm39) missense probably damaging 1.00
R5630:Prdx1 UTSW 4 116,556,414 (GRCm39) missense probably benign 0.00
R5828:Prdx1 UTSW 4 116,551,006 (GRCm39) missense probably damaging 1.00
R7861:Prdx1 UTSW 4 116,550,935 (GRCm39) missense probably benign
R8312:Prdx1 UTSW 4 116,556,398 (GRCm39) missense possibly damaging 0.83
Z1176:Prdx1 UTSW 4 116,544,678 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTGGTATAACTTGTAGCAAGCC -3'
(R):5'- GCAGCAGTCAGTGATTCCAAATC -3'

Sequencing Primer
(F):5'- TGTAGCAAGCCTATTTCCTTAGG -3'
(R):5'- TATGGTGTCTGAACAAAAAGCC -3'
Posted On 2014-12-04