Incidental Mutation 'R2568:Foxo6'
ID 254617
Institutional Source Beutler Lab
Gene Symbol Foxo6
Ensembl Gene ENSMUSG00000052135
Gene Name forkhead box O6
Synonyms
MMRRC Submission 040427-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R2568 (G1)
Quality Score 139
Status Not validated
Chromosome 4
Chromosomal Location 120124275-120144458 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120125961 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 278 (M278K)
Ref Sequence ENSEMBL: ENSMUSP00000099716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102656]
AlphaFold Q70KY4
Predicted Effect probably benign
Transcript: ENSMUST00000102656
AA Change: M278K

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099716
Gene: ENSMUSG00000052135
AA Change: M278K

DomainStartEndE-ValueType
low complexity region 33 49 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
FH 86 176 1.64e-42 SMART
low complexity region 225 239 N/A INTRINSIC
low complexity region 255 290 N/A INTRINSIC
low complexity region 301 319 N/A INTRINSIC
Pfam:FOXO_KIX_bdg 354 423 1.1e-13 PFAM
Pfam:FOXO-TAD 497 538 7.3e-24 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show defective memory consolidation with impaired neuronal synchronization and altered dendritic spine morphology. Homozygotes for another null allele show attenuated gluconeogenesis, improved glucose tolerance and increased insulin sensitivity after high fat feeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,150,161 (GRCm39) probably benign Het
Abca13 A T 11: 9,283,310 (GRCm39) N3244I probably benign Het
Adgrf5 A G 17: 43,748,562 (GRCm39) T219A probably damaging Het
Adgrg5 A T 8: 95,660,649 (GRCm39) N92I probably damaging Het
Agt A C 8: 125,283,694 (GRCm39) V475G probably damaging Het
Akap6 A G 12: 52,934,061 (GRCm39) K518E possibly damaging Het
Apoh T G 11: 108,295,697 (GRCm39) D133E probably benign Het
Axdnd1 T A 1: 156,220,319 (GRCm39) M234L possibly damaging Het
Cacna1d A G 14: 29,804,468 (GRCm39) I1335T probably damaging Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 (GRCm39) K444* probably null Het
Clasp2 A G 9: 113,707,832 (GRCm39) I614M probably benign Het
Col6a4 A T 9: 105,940,275 (GRCm39) D1218E possibly damaging Het
Cplane1 T C 15: 8,230,753 (GRCm39) V1010A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
D130043K22Rik C T 13: 25,067,874 (GRCm39) T870M probably damaging Het
Dagla C A 19: 10,225,516 (GRCm39) A883S probably benign Het
Dhx30 A G 9: 109,926,263 (GRCm39) V87A probably damaging Het
Dtx1 C A 5: 120,848,249 (GRCm39) V44L possibly damaging Het
Ecm2 T A 13: 49,683,605 (GRCm39) S528T possibly damaging Het
Eeig2 T A 3: 108,886,164 (GRCm39) N356I probably benign Het
Egfem1 A T 3: 29,637,080 (GRCm39) N172I probably damaging Het
Fam13a T G 6: 58,912,594 (GRCm39) R686S probably damaging Het
Fam243 A G 16: 92,118,207 (GRCm39) L27P probably damaging Het
Fmo1 T A 1: 162,663,828 (GRCm39) I234L probably benign Het
Foxj2 C T 6: 122,805,331 (GRCm39) R68W probably damaging Het
Fsip2 A G 2: 82,820,775 (GRCm39) S5503G probably benign Het
Gdf5 C G 2: 155,784,010 (GRCm39) R100G probably benign Het
Il1b A T 2: 129,209,242 (GRCm39) D129E probably damaging Het
Klhl29 A G 12: 5,141,350 (GRCm39) S545P probably damaging Het
Krt87 G T 15: 101,385,708 (GRCm39) R296S possibly damaging Het
Llgl1 T G 11: 60,599,638 (GRCm39) S509R probably damaging Het
Lmod1 A T 1: 135,291,702 (GRCm39) K186* probably null Het
Lrpprc C T 17: 85,034,077 (GRCm39) A973T probably damaging Het
Marco T C 1: 120,422,514 (GRCm39) H49R possibly damaging Het
Mylk4 T C 13: 32,906,001 (GRCm39) N394S probably null Het
Myo5a A G 9: 75,030,322 (GRCm39) Y147C probably damaging Het
Myo5a T C 9: 75,059,179 (GRCm39) V469A probably damaging Het
Myot A G 18: 44,470,283 (GRCm39) T87A probably benign Het
Nav2 A G 7: 49,247,312 (GRCm39) H2154R probably damaging Het
Nek10 A G 14: 14,999,112 (GRCm38) E1037G possibly damaging Het
Or1j13 T C 2: 36,369,986 (GRCm39) D52G probably damaging Het
Or52e4 A G 7: 104,705,878 (GRCm39) T142A probably benign Het
Or5k17 A G 16: 58,746,286 (GRCm39) V216A probably benign Het
Pitrm1 G T 13: 6,625,128 (GRCm39) V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,976,940 (GRCm39) probably benign Het
Prdx1 T G 4: 116,550,997 (GRCm39) I156S probably benign Het
Rbks T A 5: 31,823,096 (GRCm39) T107S probably damaging Het
Ryr3 G A 2: 112,506,219 (GRCm39) R3468W probably damaging Het
Scn1a C T 2: 66,103,813 (GRCm39) D1805N probably damaging Het
Sirpa T C 2: 129,457,568 (GRCm39) V214A probably benign Het
Slc35c1 T C 2: 92,289,225 (GRCm39) N94D probably benign Het
Sorbs2 A T 8: 46,248,407 (GRCm39) K553* probably null Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thg1l A G 11: 45,842,392 (GRCm39) V142A probably benign Het
Tiparp T A 3: 65,460,551 (GRCm39) Y513* probably null Het
Tmc6 A G 11: 117,663,646 (GRCm39) V522A probably benign Het
Trim39 T A 17: 36,580,056 (GRCm39) probably benign Het
Trrap G A 5: 144,780,179 (GRCm39) probably null Het
Tulp3 C T 6: 128,304,601 (GRCm39) V218I probably benign Het
Vmn1r38 T A 6: 66,753,955 (GRCm39) I54F probably benign Het
Vmn2r23 T A 6: 123,719,147 (GRCm39) Y833* probably null Het
Zfp810 A T 9: 22,190,534 (GRCm39) S125T probably benign Het
Other mutations in Foxo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Foxo6 APN 4 120,126,349 (GRCm39) missense probably benign 0.09
IGL02441:Foxo6 APN 4 120,125,232 (GRCm39) missense possibly damaging 0.52
R0284:Foxo6 UTSW 4 120,126,199 (GRCm39) missense probably benign 0.01
R2044:Foxo6 UTSW 4 120,144,166 (GRCm39) missense probably benign 0.40
R2152:Foxo6 UTSW 4 120,125,811 (GRCm39) missense probably benign 0.03
R3008:Foxo6 UTSW 4 120,125,961 (GRCm39) missense probably benign 0.11
R7352:Foxo6 UTSW 4 120,125,448 (GRCm39) missense probably benign 0.02
R8724:Foxo6 UTSW 4 120,144,109 (GRCm39) missense probably damaging 1.00
R8951:Foxo6 UTSW 4 120,125,133 (GRCm39) missense unknown
Z1187:Foxo6 UTSW 4 120,144,332 (GRCm39) missense possibly damaging 0.93
Z1188:Foxo6 UTSW 4 120,144,332 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTCCTGGATGGTCTGCATG -3'
(R):5'- CCAAGTTCCTGCGCATCAAG -3'

Sequencing Primer
(F):5'- TTGCAGCTGCCGAAGTAG -3'
(R):5'- AGAAGCAGCTGCACCTG -3'
Posted On 2014-12-04