Incidental Mutation 'R2568:Rbks'
ID254619
Institutional Source Beutler Lab
Gene Symbol Rbks
Ensembl Gene ENSMUSG00000029136
Gene Nameribokinase
Synonyms
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31624439-31697627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31665752 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 107 (T107S)
Ref Sequence ENSEMBL: ENSMUSP00000031018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000201910]
Predicted Effect probably damaging
Transcript: ENSMUST00000031018
AA Change: T107S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136
AA Change: T107S

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200694
Predicted Effect probably benign
Transcript: ENSMUST00000201910
SMART Domains Protein: ENSMUSP00000144669
Gene: ENSMUSG00000106918

DomainStartEndE-ValueType
PDB:4CE4|6 1 49 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202690
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Rbks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Rbks APN 5 31660017 missense probably damaging 1.00
IGL02618:Rbks APN 5 31624519 nonsense probably null
IGL02678:Rbks APN 5 31673413 missense probably damaging 1.00
IGL02719:Rbks APN 5 31651801 intron probably benign
IGL02947:Rbks APN 5 31660063 missense probably benign
R0334:Rbks UTSW 5 31624519 nonsense probably null
R1441:Rbks UTSW 5 31659997 missense probably benign
R4545:Rbks UTSW 5 31624568 missense probably benign 0.10
R4546:Rbks UTSW 5 31624568 missense probably benign 0.10
R4591:Rbks UTSW 5 31660008 missense possibly damaging 0.52
R4833:Rbks UTSW 5 31624515 missense probably benign 0.00
R4967:Rbks UTSW 5 31624532 missense probably damaging 1.00
R5076:Rbks UTSW 5 31650451 nonsense probably null
R5214:Rbks UTSW 5 31650392 intron probably benign
R6051:Rbks UTSW 5 31651819 missense probably damaging 1.00
R6194:Rbks UTSW 5 31666890 missense probably benign 0.05
R6607:Rbks UTSW 5 31647792 missense possibly damaging 0.92
R7246:Rbks UTSW 5 31647783 missense possibly damaging 0.58
Z1177:Rbks UTSW 5 31647863 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTTCACACATATTAGACAGAGC -3'
(R):5'- AGATGCCCATTTCCTCACTG -3'

Sequencing Primer
(F):5'- ATTTTACAAATGATCAAGGAGGGG -3'
(R):5'- CCATTTCCTCACTGTATAGGTGATGG -3'
Posted On2014-12-04