Incidental Mutation 'R2568:Fam13a'
ID254623
Institutional Source Beutler Lab
Gene Symbol Fam13a
Ensembl Gene ENSMUSG00000037709
Gene Namefamily with sequence similarity 13, member A
SynonymsD430015B01Rik
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location58932090-59024549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 58935609 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 686 (R686S)
Ref Sequence ENSEMBL: ENSMUSP00000087304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089860] [ENSMUST00000173193]
Predicted Effect probably damaging
Transcript: ENSMUST00000089860
AA Change: R686S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087304
Gene: ENSMUSG00000037709
AA Change: R686S

DomainStartEndE-ValueType
Blast:RhoGAP 19 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 620 645 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173193
AA Change: R658S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134135
Gene: ENSMUSG00000037709
AA Change: R658S

DomainStartEndE-ValueType
Blast:RhoGAP 21 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 592 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Fam13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Fam13a APN 6 58946126 missense probably benign 0.03
IGL00467:Fam13a APN 6 58940113 splice site probably benign
IGL01288:Fam13a APN 6 58956727 missense probably damaging 1.00
IGL01503:Fam13a APN 6 58956080 missense probably damaging 1.00
IGL01532:Fam13a APN 6 58940295 missense probably damaging 0.96
IGL02197:Fam13a APN 6 58935601 missense possibly damaging 0.65
IGL02206:Fam13a APN 6 58987219 missense probably benign 0.00
IGL03189:Fam13a APN 6 58956858 missense probably damaging 0.99
BB009:Fam13a UTSW 6 58983888 critical splice donor site probably null
BB019:Fam13a UTSW 6 58983888 critical splice donor site probably null
R0361:Fam13a UTSW 6 58987174 missense probably benign
R0512:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R0801:Fam13a UTSW 6 58984012 missense probably benign 0.01
R1222:Fam13a UTSW 6 58935722 splice site probably benign
R1378:Fam13a UTSW 6 58956751 missense probably benign 0.04
R1535:Fam13a UTSW 6 58939347 missense probably damaging 0.99
R1614:Fam13a UTSW 6 58940184 missense probably damaging 1.00
R1663:Fam13a UTSW 6 58954372 nonsense probably null
R1809:Fam13a UTSW 6 58965060 critical splice donor site probably null
R1905:Fam13a UTSW 6 58953490 missense probably damaging 1.00
R3771:Fam13a UTSW 6 58987186 missense probably benign 0.11
R4654:Fam13a UTSW 6 58987167 missense probably benign
R5244:Fam13a UTSW 6 58953474 nonsense probably null
R5488:Fam13a UTSW 6 59024318 missense probably null 1.00
R5489:Fam13a UTSW 6 59024318 missense probably null 1.00
R5712:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R5729:Fam13a UTSW 6 58939307 missense probably damaging 0.99
R5969:Fam13a UTSW 6 58965198 missense probably damaging 1.00
R6074:Fam13a UTSW 6 58989738 splice site probably null
R6275:Fam13a UTSW 6 58954257 missense probably damaging 0.98
R6306:Fam13a UTSW 6 58940254 missense probably benign 0.02
R6338:Fam13a UTSW 6 58953499 missense probably damaging 1.00
R6603:Fam13a UTSW 6 58987189 missense probably benign 0.31
R7508:Fam13a UTSW 6 58987284 missense probably damaging 1.00
R7516:Fam13a UTSW 6 58955263 missense probably damaging 1.00
R7688:Fam13a UTSW 6 58935707 missense probably benign 0.05
R7728:Fam13a UTSW 6 58954299 missense possibly damaging 0.79
R7932:Fam13a UTSW 6 58983888 critical splice donor site probably null
R8080:Fam13a UTSW 6 58956805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTTCTAAGGCAGGCAATGG -3'
(R):5'- CAAGAGTCAGCTGTCAACAGTG -3'

Sequencing Primer
(F):5'- TGGAAGCAGGAGTCAATCTG -3'
(R):5'- ATGATCATCCCTGGTGAATTGTAGCC -3'
Posted On2014-12-04