Incidental Mutation 'R2568:Vmn2r23'
ID 254626
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 040427-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R2568 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 123719147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 833 (Y833*)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably null
Transcript: ENSMUST00000172391
AA Change: Y833*
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: Y833*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,150,161 (GRCm39) probably benign Het
Abca13 A T 11: 9,283,310 (GRCm39) N3244I probably benign Het
Adgrf5 A G 17: 43,748,562 (GRCm39) T219A probably damaging Het
Adgrg5 A T 8: 95,660,649 (GRCm39) N92I probably damaging Het
Agt A C 8: 125,283,694 (GRCm39) V475G probably damaging Het
Akap6 A G 12: 52,934,061 (GRCm39) K518E possibly damaging Het
Apoh T G 11: 108,295,697 (GRCm39) D133E probably benign Het
Axdnd1 T A 1: 156,220,319 (GRCm39) M234L possibly damaging Het
Cacna1d A G 14: 29,804,468 (GRCm39) I1335T probably damaging Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 (GRCm39) K444* probably null Het
Clasp2 A G 9: 113,707,832 (GRCm39) I614M probably benign Het
Col6a4 A T 9: 105,940,275 (GRCm39) D1218E possibly damaging Het
Cplane1 T C 15: 8,230,753 (GRCm39) V1010A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
D130043K22Rik C T 13: 25,067,874 (GRCm39) T870M probably damaging Het
Dagla C A 19: 10,225,516 (GRCm39) A883S probably benign Het
Dhx30 A G 9: 109,926,263 (GRCm39) V87A probably damaging Het
Dtx1 C A 5: 120,848,249 (GRCm39) V44L possibly damaging Het
Ecm2 T A 13: 49,683,605 (GRCm39) S528T possibly damaging Het
Eeig2 T A 3: 108,886,164 (GRCm39) N356I probably benign Het
Egfem1 A T 3: 29,637,080 (GRCm39) N172I probably damaging Het
Fam13a T G 6: 58,912,594 (GRCm39) R686S probably damaging Het
Fam243 A G 16: 92,118,207 (GRCm39) L27P probably damaging Het
Fmo1 T A 1: 162,663,828 (GRCm39) I234L probably benign Het
Foxj2 C T 6: 122,805,331 (GRCm39) R68W probably damaging Het
Foxo6 A T 4: 120,125,961 (GRCm39) M278K probably benign Het
Fsip2 A G 2: 82,820,775 (GRCm39) S5503G probably benign Het
Gdf5 C G 2: 155,784,010 (GRCm39) R100G probably benign Het
Il1b A T 2: 129,209,242 (GRCm39) D129E probably damaging Het
Klhl29 A G 12: 5,141,350 (GRCm39) S545P probably damaging Het
Krt87 G T 15: 101,385,708 (GRCm39) R296S possibly damaging Het
Llgl1 T G 11: 60,599,638 (GRCm39) S509R probably damaging Het
Lmod1 A T 1: 135,291,702 (GRCm39) K186* probably null Het
Lrpprc C T 17: 85,034,077 (GRCm39) A973T probably damaging Het
Marco T C 1: 120,422,514 (GRCm39) H49R possibly damaging Het
Mylk4 T C 13: 32,906,001 (GRCm39) N394S probably null Het
Myo5a A G 9: 75,030,322 (GRCm39) Y147C probably damaging Het
Myo5a T C 9: 75,059,179 (GRCm39) V469A probably damaging Het
Myot A G 18: 44,470,283 (GRCm39) T87A probably benign Het
Nav2 A G 7: 49,247,312 (GRCm39) H2154R probably damaging Het
Nek10 A G 14: 14,999,112 (GRCm38) E1037G possibly damaging Het
Or1j13 T C 2: 36,369,986 (GRCm39) D52G probably damaging Het
Or52e4 A G 7: 104,705,878 (GRCm39) T142A probably benign Het
Or5k17 A G 16: 58,746,286 (GRCm39) V216A probably benign Het
Pitrm1 G T 13: 6,625,128 (GRCm39) V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,976,940 (GRCm39) probably benign Het
Prdx1 T G 4: 116,550,997 (GRCm39) I156S probably benign Het
Rbks T A 5: 31,823,096 (GRCm39) T107S probably damaging Het
Ryr3 G A 2: 112,506,219 (GRCm39) R3468W probably damaging Het
Scn1a C T 2: 66,103,813 (GRCm39) D1805N probably damaging Het
Sirpa T C 2: 129,457,568 (GRCm39) V214A probably benign Het
Slc35c1 T C 2: 92,289,225 (GRCm39) N94D probably benign Het
Sorbs2 A T 8: 46,248,407 (GRCm39) K553* probably null Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thg1l A G 11: 45,842,392 (GRCm39) V142A probably benign Het
Tiparp T A 3: 65,460,551 (GRCm39) Y513* probably null Het
Tmc6 A G 11: 117,663,646 (GRCm39) V522A probably benign Het
Trim39 T A 17: 36,580,056 (GRCm39) probably benign Het
Trrap G A 5: 144,780,179 (GRCm39) probably null Het
Tulp3 C T 6: 128,304,601 (GRCm39) V218I probably benign Het
Vmn1r38 T A 6: 66,753,955 (GRCm39) I54F probably benign Het
Zfp810 A T 9: 22,190,534 (GRCm39) S125T probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCTGGCCAGTCTCAGCTTG -3'
(R):5'- GGATTGCAGAGTCAGATGCC -3'

Sequencing Primer
(F):5'- GCTACCTGACAGCTTCAATGAGG -3'
(R):5'- CAGAGTCAGATGCCATTGTTTAG -3'
Posted On 2014-12-04