Incidental Mutation 'R2568:Tulp3'
ID254627
Institutional Source Beutler Lab
Gene Symbol Tulp3
Ensembl Gene ENSMUSG00000001521
Gene Nametubby-like protein 3
Synonyms2310022L06Rik
MMRRC Submission 040427-MU
Accession Numbers

Genbank: NM_011657; MGI: 1329045

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128321161-128355851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128327638 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 218 (V218I)
Ref Sequence ENSEMBL: ENSMUSP00000001562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001562]
Predicted Effect probably benign
Transcript: ENSMUST00000001562
AA Change: V218I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000001562
Gene: ENSMUSG00000001521
AA Change: V218I

DomainStartEndE-ValueType
Pfam:Tub_N 30 84 1.7e-23 PFAM
Pfam:Tub_N 76 198 5.5e-16 PFAM
Pfam:Tub 213 454 1e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138313
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby gene family of bipartite transcription factors. Members of this family have been identified in plants, vertebrates, and invertebrates, and they share a conserved N-terminal transcription activation region and a conserved C-terminal DNA and phosphatidylinositol-phosphate binding region. The encoded protein binds to phosphoinositides in the plasma membrane via its C-terminal region and probably functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis, for instance, induced by G-protein-coupled-receptor signaling. It plays an important role in neuronal development and function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutant mice exhibit failed neural tube closure followed by neuroepithelial apoptosis and ultimately embryonic death around E14.5. Heterozygotes are largely phenotypically normal, however some exhibit neuroepithelial apoptosis and die as embryos. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, other(3) Gene trapped(31) Chemically induced(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Tulp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Tulp3 APN 6 128325884 missense probably damaging 0.99
IGL01327:Tulp3 APN 6 128327634 missense probably damaging 1.00
IGL01382:Tulp3 APN 6 128325070 missense probably damaging 1.00
IGL01633:Tulp3 APN 6 128325960 missense probably damaging 1.00
IGL02228:Tulp3 APN 6 128334485 missense probably damaging 1.00
IGL02372:Tulp3 APN 6 128327598 missense possibly damaging 0.92
D4043:Tulp3 UTSW 6 128324150 missense probably benign 0.06
R0243:Tulp3 UTSW 6 128325958 nonsense probably null
R1181:Tulp3 UTSW 6 128325952 missense possibly damaging 0.47
R1673:Tulp3 UTSW 6 128333943 splice site probably null
R1749:Tulp3 UTSW 6 128337759 missense probably damaging 1.00
R1984:Tulp3 UTSW 6 128326806 missense probably benign 0.02
R1985:Tulp3 UTSW 6 128326806 missense probably benign 0.02
R4660:Tulp3 UTSW 6 128323054 utr 3 prime probably benign
R4779:Tulp3 UTSW 6 128323120 missense probably damaging 1.00
R5001:Tulp3 UTSW 6 128325068 missense probably damaging 1.00
R6192:Tulp3 UTSW 6 128355740 splice site probably null
R6242:Tulp3 UTSW 6 128323087 missense probably damaging 1.00
R7464:Tulp3 UTSW 6 128326829 missense probably benign 0.00
R7782:Tulp3 UTSW 6 128324980 missense possibly damaging 0.69
R7883:Tulp3 UTSW 6 128326844 missense probably damaging 1.00
R8027:Tulp3 UTSW 6 128334473 missense probably benign 0.00
R8235:Tulp3 UTSW 6 128327677 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACAACCTTGTCCTCTTGGG -3'
(R):5'- AGACAGAGGGTTTGGTCCAC -3'

Sequencing Primer
(F):5'- CTCAGGCTTAGGAGGTGGC -3'
(R):5'- TGGTCCACCAAGTGTCTGTCG -3'
Posted On2014-12-04