Mutagenetix > Incidental Mutations

Incidental Mutation 'R2568:Cdh15'

254633

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

040427-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 122862024 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 279 (R279Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034443
AA Change: R279Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: R279Q

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,201,269	V1010A	possibly damaging	Het
4930563D23Rik	A	G	16: 92,321,319	L27P	probably damaging	Het
A730071L15Rik	A	T	11: 6,200,161		probably benign	Het
Abca13	A	T	11: 9,333,310	N3244I	probably benign	Het
Adgrf5	A	G	17: 43,437,671	T219A	probably damaging	Het
Adgrg5	A	T	8: 94,934,021	N92I	probably damaging	Het
Agt	A	C	8: 124,556,955	V475G	probably damaging	Het
Akap6	A	G	12: 52,887,278	K518E	possibly damaging	Het
Apoh	T	G	11: 108,404,871	D133E	probably benign	Het
Axdnd1	T	A	1: 156,392,749	M234L	possibly damaging	Het
Cacna1d	A	G	14: 30,082,511	I1335T	probably damaging	Het
Cfap206	T	A	4: 34,711,566	K444*	probably null	Het
Clasp2	A	G	9: 113,878,764	I614M	probably benign	Het
Col6a4	A	T	9: 106,063,076	D1218E	possibly damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
D130043K22Rik	C	T	13: 24,883,891	T870M	probably damaging	Het
Dagla	C	A	19: 10,248,152	A883S	probably benign	Het
Dhx30	A	G	9: 110,097,195	V87A	probably damaging	Het
Dtx1	C	A	5: 120,710,184	V44L	possibly damaging	Het
Ecm2	T	A	13: 49,530,129	S528T	possibly damaging	Het
Egfem1	A	T	3: 29,582,931	N172I	probably damaging	Het
Fam102b	T	A	3: 108,978,848	N356I	probably benign	Het
Fam13a	T	G	6: 58,935,609	R686S	probably damaging	Het
Fmo1	T	A	1: 162,836,259	I234L	probably benign	Het
Foxj2	C	T	6: 122,828,372	R68W	probably damaging	Het
Foxo6	A	T	4: 120,268,764	M278K	probably benign	Het
Fsip2	A	G	2: 82,990,431	S5503G	probably benign	Het
Gdf5	C	G	2: 155,942,090	R100G	probably benign	Het
Il1b	A	T	2: 129,367,322	D129E	probably damaging	Het
Klhl29	A	G	12: 5,091,350	S545P	probably damaging	Het
Krt83	G	T	15: 101,487,827	R296S	possibly damaging	Het
Llgl1	T	G	11: 60,708,812	S509R	probably damaging	Het
Lmod1	A	T	1: 135,363,964	K186*	probably null	Het
Lrpprc	C	T	17: 84,726,649	A973T	probably damaging	Het
Marco	T	C	1: 120,494,785	H49R	possibly damaging	Het
Mylk4	T	C	13: 32,722,018	N394S	probably null	Het
Myo5a	A	G	9: 75,123,040	Y147C	probably damaging	Het
Myo5a	T	C	9: 75,151,897	V469A	probably damaging	Het
Myot	A	G	18: 44,337,216	T87A	probably benign	Het
Nav2	A	G	7: 49,597,564	H2154R	probably damaging	Het
Nek10	A	G	14: 14,999,112	E1037G	possibly damaging	Het
Olfr181	A	G	16: 58,925,923	V216A	probably benign	Het
Olfr341	T	C	2: 36,479,974	D52G	probably damaging	Het
Olfr677	A	G	7: 105,056,671	T142A	probably benign	Het
Pitrm1	G	T	13: 6,575,092	V869F	probably benign	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Prdx1	T	G	4: 116,693,800	I156S	probably benign	Het
Rbks	T	A	5: 31,665,752	T107S	probably damaging	Het
Ryr3	G	A	2: 112,675,874	R3468W	probably damaging	Het
Scn1a	C	T	2: 66,273,469	D1805N	probably damaging	Het
Sirpa	T	C	2: 129,615,648	V214A	probably benign	Het
Slc35c1	T	C	2: 92,458,880	N94D	probably benign	Het
Sorbs2	A	T	8: 45,795,370	K553*	probably null	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Thg1l	A	G	11: 45,951,565	V142A	probably benign	Het
Tiparp	T	A	3: 65,553,130	Y513*	probably null	Het
Tmc6	A	G	11: 117,772,820	V522A	probably benign	Het
Trim39	T	A	17: 36,269,164		probably benign	Het
Trrap	G	A	5: 144,843,369		probably null	Het
Tulp3	C	T	6: 128,327,638	V218I	probably benign	Het
Vmn1r38	T	A	6: 66,776,971	I54F	probably benign	Het
Vmn2r23	T	A	6: 123,742,188	Y833*	probably null	Het
Zfp810	A	T	9: 22,279,238	S125T	probably benign	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1317:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	122864348	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	122856587	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTCCAATATCCAGGAGCAG -3'
(R):5'- GATTCTAGCTGAGGGAACACAC -3'

Sequencing Primer
(F):5'- TGGGATCCATGGCTCTGGAAAC -3'
(R):5'- TTCTAGCTGAGGGAACACACATGAC -3'

Posted On

2014-12-04