Incidental Mutation 'R2568:Agt'
ID254634
Institutional Source Beutler Lab
Gene Symbol Agt
Ensembl Gene ENSMUSG00000031980
Gene Nameangiotensinogen (serpin peptidase inhibitor, clade A, member 8)
SynonymsAogen, angiotensin precursor, Serpina8
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2568 (G1)
Quality Score219
Status Not validated
Chromosome8
Chromosomal Location124556534-124569706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 124556955 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 475 (V475G)
Ref Sequence ENSEMBL: ENSMUSP00000066488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000063278]
Predicted Effect probably benign
Transcript: ENSMUST00000034460
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063278
AA Change: V475G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066488
Gene: ENSMUSG00000031980
AA Change: V475G

DomainStartEndE-ValueType
SERPIN 111 478 6.63e-57 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in small body size and lower body fat, decreased blood pressure and hypotension, kidney abnormalities, polydipsia and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Agt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Agt APN 8 124557895 splice site probably benign
IGL01648:Agt APN 8 124564406 missense probably benign 0.01
IGL02145:Agt APN 8 124564448 missense probably damaging 0.99
IGL02929:Agt APN 8 124557090 missense probably benign
IGL02978:Agt APN 8 124557763 missense possibly damaging 0.93
IGL03207:Agt APN 8 124559368 missense probably damaging 0.98
R0518:Agt UTSW 8 124557100 nonsense probably null
R0521:Agt UTSW 8 124557100 nonsense probably null
R0562:Agt UTSW 8 124559275 missense probably benign 0.00
R0591:Agt UTSW 8 124556939 missense possibly damaging 0.77
R0646:Agt UTSW 8 124557113 missense probably damaging 1.00
R1495:Agt UTSW 8 124559455 missense probably damaging 1.00
R4750:Agt UTSW 8 124556937 missense probably benign
R4941:Agt UTSW 8 124556988 missense probably benign 0.32
R5782:Agt UTSW 8 124557131 splice site probably null
R5916:Agt UTSW 8 124563858 missense possibly damaging 0.70
R6332:Agt UTSW 8 124557833 missense possibly damaging 0.92
R7769:Agt UTSW 8 124564550 missense probably benign 0.41
R8354:Agt UTSW 8 124564103 missense probably benign 0.06
R8443:Agt UTSW 8 124563798 missense possibly damaging 0.82
R8454:Agt UTSW 8 124564103 missense probably benign 0.06
R8808:Agt UTSW 8 124564289 missense probably benign 0.01
X0067:Agt UTSW 8 124556955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTCCAGAGTGGCAGTCC -3'
(R):5'- TGCAGGTTCTCAATAGCATCCTC -3'

Sequencing Primer
(F):5'- TGCAGAGTGCCAGCTTCTG -3'
(R):5'- TCCTCGAACTCAAAGCAGGAGAG -3'
Posted On2014-12-04