Mutagenetix > Incidental Mutations

Incidental Mutation 'R2568:Myo5a'

254637

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

040427-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R2568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75123040 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 147 (Y147C)

Ref Sequence

ENSEMBL: ENSMUSP00000117493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: Y147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: Y147C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

probably damaging
Transcript: ENSMUST00000136731
AA Change: Y147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: Y147C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136871

Predicted Effect

probably damaging
Transcript: ENSMUST00000155282
AA Change: Y147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: Y147C

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,201,269	V1010A	possibly damaging	Het
4930563D23Rik	A	G	16: 92,321,319	L27P	probably damaging	Het
A730071L15Rik	A	T	11: 6,200,161		probably benign	Het
Abca13	A	T	11: 9,333,310	N3244I	probably benign	Het
Adgrf5	A	G	17: 43,437,671	T219A	probably damaging	Het
Adgrg5	A	T	8: 94,934,021	N92I	probably damaging	Het
Agt	A	C	8: 124,556,955	V475G	probably damaging	Het
Akap6	A	G	12: 52,887,278	K518E	possibly damaging	Het
Apoh	T	G	11: 108,404,871	D133E	probably benign	Het
Axdnd1	T	A	1: 156,392,749	M234L	possibly damaging	Het
Cacna1d	A	G	14: 30,082,511	I1335T	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cfap206	T	A	4: 34,711,566	K444*	probably null	Het
Clasp2	A	G	9: 113,878,764	I614M	probably benign	Het
Col6a4	A	T	9: 106,063,076	D1218E	possibly damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
D130043K22Rik	C	T	13: 24,883,891	T870M	probably damaging	Het
Dagla	C	A	19: 10,248,152	A883S	probably benign	Het
Dhx30	A	G	9: 110,097,195	V87A	probably damaging	Het
Dtx1	C	A	5: 120,710,184	V44L	possibly damaging	Het
Ecm2	T	A	13: 49,530,129	S528T	possibly damaging	Het
Egfem1	A	T	3: 29,582,931	N172I	probably damaging	Het
Fam102b	T	A	3: 108,978,848	N356I	probably benign	Het
Fam13a	T	G	6: 58,935,609	R686S	probably damaging	Het
Fmo1	T	A	1: 162,836,259	I234L	probably benign	Het
Foxj2	C	T	6: 122,828,372	R68W	probably damaging	Het
Foxo6	A	T	4: 120,268,764	M278K	probably benign	Het
Fsip2	A	G	2: 82,990,431	S5503G	probably benign	Het
Gdf5	C	G	2: 155,942,090	R100G	probably benign	Het
Il1b	A	T	2: 129,367,322	D129E	probably damaging	Het
Klhl29	A	G	12: 5,091,350	S545P	probably damaging	Het
Krt83	G	T	15: 101,487,827	R296S	possibly damaging	Het
Llgl1	T	G	11: 60,708,812	S509R	probably damaging	Het
Lmod1	A	T	1: 135,363,964	K186*	probably null	Het
Lrpprc	C	T	17: 84,726,649	A973T	probably damaging	Het
Marco	T	C	1: 120,494,785	H49R	possibly damaging	Het
Mylk4	T	C	13: 32,722,018	N394S	probably null	Het
Myot	A	G	18: 44,337,216	T87A	probably benign	Het
Nav2	A	G	7: 49,597,564	H2154R	probably damaging	Het
Nek10	A	G	14: 14,999,112	E1037G	possibly damaging	Het
Olfr181	A	G	16: 58,925,923	V216A	probably benign	Het
Olfr341	T	C	2: 36,479,974	D52G	probably damaging	Het
Olfr677	A	G	7: 105,056,671	T142A	probably benign	Het
Pitrm1	G	T	13: 6,575,092	V869F	probably benign	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Prdx1	T	G	4: 116,693,800	I156S	probably benign	Het
Rbks	T	A	5: 31,665,752	T107S	probably damaging	Het
Ryr3	G	A	2: 112,675,874	R3468W	probably damaging	Het
Scn1a	C	T	2: 66,273,469	D1805N	probably damaging	Het
Sirpa	T	C	2: 129,615,648	V214A	probably benign	Het
Slc35c1	T	C	2: 92,458,880	N94D	probably benign	Het
Sorbs2	A	T	8: 45,795,370	K553*	probably null	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Thg1l	A	G	11: 45,951,565	V142A	probably benign	Het
Tiparp	T	A	3: 65,553,130	Y513*	probably null	Het
Tmc6	A	G	11: 117,772,820	V522A	probably benign	Het
Trim39	T	A	17: 36,269,164		probably benign	Het
Trrap	G	A	5: 144,843,369		probably null	Het
Tulp3	C	T	6: 128,327,638	V218I	probably benign	Het
Vmn1r38	T	A	6: 66,776,971	I54F	probably benign	Het
Vmn2r23	T	A	6: 123,742,188	Y833*	probably null	Het
Zfp810	A	T	9: 22,279,238	S125T	probably benign	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- GCCCTGTAGGAGATGATTGATGTC -3'
(R):5'- TGAGACACACTCTGCAGAGG -3'

Sequencing Primer
(F):5'- TGTAGGAGATGATTGATGTCATTTTC -3'
(R):5'- GTCCTTGCTTAGTCACAAGAAC -3'

Posted On

2014-12-04