Mutagenetix > Incidental Mutation

Incidental Mutation 'R2568:Col6a4'

254639

Institutional Source

Beutler Lab

Gene Symbol

Col6a4

Ensembl Gene

ENSMUSG00000032572

Gene Name

collagen, type VI, alpha 4

Synonyms

Vwa6, 1110001D15Rik, EG235580, Dvwa

MMRRC Submission

040427-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105989454-106096783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 106063076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1218 (D1218E)

Ref Sequence

ENSEMBL: ENSMUSP00000112472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000121963]

AlphaFold

A2AX52

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121963
AA Change: D1218E

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: D1218E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
VWA	32	211	2.44e-35	SMART
VWA	233	410	8.67e-50	SMART
VWA	428	604	2.74e-29	SMART
VWA	632	816	4.78e-20	SMART
VWA	847	1019	3.02e-40	SMART
VWA	1028	1204	3.17e-43	SMART
VWA	1210	1391	4.73e-1	SMART
low complexity region	1444	1462	N/A	INTRINSIC
PDB:3HR2\|B	1469	1593	3e-7	PDB
low complexity region	1594	1622	N/A	INTRINSIC
low complexity region	1625	1643	N/A	INTRINSIC
low complexity region	1649	1671	N/A	INTRINSIC
Pfam:Collagen	1684	1748	1.4e-9	PFAM
VWA	1774	1953	2.18e-14	SMART
VWA	1980	2174	1.89e-9	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,201,269	V1010A	possibly damaging	Het
4930563D23Rik	A	G	16: 92,321,319	L27P	probably damaging	Het
A730071L15Rik	A	T	11: 6,200,161		probably benign	Het
Abca13	A	T	11: 9,333,310	N3244I	probably benign	Het
Adgrf5	A	G	17: 43,437,671	T219A	probably damaging	Het
Adgrg5	A	T	8: 94,934,021	N92I	probably damaging	Het
Agt	A	C	8: 124,556,955	V475G	probably damaging	Het
Akap6	A	G	12: 52,887,278	K518E	possibly damaging	Het
Apoh	T	G	11: 108,404,871	D133E	probably benign	Het
Axdnd1	T	A	1: 156,392,749	M234L	possibly damaging	Het
Cacna1d	A	G	14: 30,082,511	I1335T	probably damaging	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cfap206	T	A	4: 34,711,566	K444*	probably null	Het
Clasp2	A	G	9: 113,878,764	I614M	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
D130043K22Rik	C	T	13: 24,883,891	T870M	probably damaging	Het
Dagla	C	A	19: 10,248,152	A883S	probably benign	Het
Dhx30	A	G	9: 110,097,195	V87A	probably damaging	Het
Dtx1	C	A	5: 120,710,184	V44L	possibly damaging	Het
Ecm2	T	A	13: 49,530,129	S528T	possibly damaging	Het
Egfem1	A	T	3: 29,582,931	N172I	probably damaging	Het
Fam102b	T	A	3: 108,978,848	N356I	probably benign	Het
Fam13a	T	G	6: 58,935,609	R686S	probably damaging	Het
Fmo1	T	A	1: 162,836,259	I234L	probably benign	Het
Foxj2	C	T	6: 122,828,372	R68W	probably damaging	Het
Foxo6	A	T	4: 120,268,764	M278K	probably benign	Het
Fsip2	A	G	2: 82,990,431	S5503G	probably benign	Het
Gdf5	C	G	2: 155,942,090	R100G	probably benign	Het
Il1b	A	T	2: 129,367,322	D129E	probably damaging	Het
Klhl29	A	G	12: 5,091,350	S545P	probably damaging	Het
Krt83	G	T	15: 101,487,827	R296S	possibly damaging	Het
Llgl1	T	G	11: 60,708,812	S509R	probably damaging	Het
Lmod1	A	T	1: 135,363,964	K186*	probably null	Het
Lrpprc	C	T	17: 84,726,649	A973T	probably damaging	Het
Marco	T	C	1: 120,494,785	H49R	possibly damaging	Het
Mylk4	T	C	13: 32,722,018	N394S	probably null	Het
Myo5a	A	G	9: 75,123,040	Y147C	probably damaging	Het
Myo5a	T	C	9: 75,151,897	V469A	probably damaging	Het
Myot	A	G	18: 44,337,216	T87A	probably benign	Het
Nav2	A	G	7: 49,597,564	H2154R	probably damaging	Het
Nek10	A	G	14: 14,999,112	E1037G	possibly damaging	Het
Olfr181	A	G	16: 58,925,923	V216A	probably benign	Het
Olfr341	T	C	2: 36,479,974	D52G	probably damaging	Het
Olfr677	A	G	7: 105,056,671	T142A	probably benign	Het
Pitrm1	G	T	13: 6,575,092	V869F	probably benign	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Prdx1	T	G	4: 116,693,800	I156S	probably benign	Het
Rbks	T	A	5: 31,665,752	T107S	probably damaging	Het
Ryr3	G	A	2: 112,675,874	R3468W	probably damaging	Het
Scn1a	C	T	2: 66,273,469	D1805N	probably damaging	Het
Sirpa	T	C	2: 129,615,648	V214A	probably benign	Het
Slc35c1	T	C	2: 92,458,880	N94D	probably benign	Het
Sorbs2	A	T	8: 45,795,370	K553*	probably null	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Thg1l	A	G	11: 45,951,565	V142A	probably benign	Het
Tiparp	T	A	3: 65,553,130	Y513*	probably null	Het
Tmc6	A	G	11: 117,772,820	V522A	probably benign	Het
Trim39	T	A	17: 36,269,164		probably benign	Het
Trrap	G	A	5: 144,843,369		probably null	Het
Tulp3	C	T	6: 128,327,638	V218I	probably benign	Het
Vmn1r38	T	A	6: 66,776,971	I54F	probably benign	Het
Vmn2r23	T	A	6: 123,742,188	Y833*	probably null	Het
Zfp810	A	T	9: 22,279,238	S125T	probably benign	Het

Other mutations in Col6a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Col6a4	APN	9	106022896	missense	probably benign	0.00
IGL00691:Col6a4	APN	9	106057407	missense	probably damaging	1.00
IGL01508:Col6a4	APN	9	106013605	missense	possibly damaging	0.95
IGL01580:Col6a4	APN	9	106068198	missense	probably damaging	1.00
IGL01610:Col6a4	APN	9	106047707	splice site	probably benign
IGL01813:Col6a4	APN	9	106077253	missense	probably damaging	1.00
IGL01933:Col6a4	APN	9	106060114	missense	probably benign	0.04
IGL01973:Col6a4	APN	9	106062894	missense	probably damaging	1.00
IGL02053:Col6a4	APN	9	106063095	missense	possibly damaging	0.92
IGL02063:Col6a4	APN	9	106057418	missense	probably benign	0.01
IGL02065:Col6a4	APN	9	106077103	missense	probably damaging	0.99
IGL02106:Col6a4	APN	9	106063105	missense	possibly damaging	0.95
IGL02220:Col6a4	APN	9	106062942	missense	possibly damaging	0.91
IGL02228:Col6a4	APN	9	106068078	missense	probably benign
IGL02234:Col6a4	APN	9	106013432	missense	possibly damaging	0.92
IGL02294:Col6a4	APN	9	106066732	missense	probably benign	0.04
IGL02314:Col6a4	APN	9	105997156	missense	probably damaging	0.99
IGL03065:Col6a4	APN	9	106041164	splice site	probably benign
IGL03086:Col6a4	APN	9	106082862	splice site	probably benign
IGL03185:Col6a4	APN	9	106019454	missense	probably damaging	0.97
R0092:Col6a4	UTSW	9	106013314	missense	probably benign	0.04
R0095:Col6a4	UTSW	9	106075356	missense	probably benign	0.03
R0230:Col6a4	UTSW	9	106072366	missense	probably benign	0.11
R0359:Col6a4	UTSW	9	105997146	missense	probably benign
R0415:Col6a4	UTSW	9	106075080	missense	probably damaging	0.99
R0433:Col6a4	UTSW	9	106067994	missense	probably damaging	0.99
R0450:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0469:Col6a4	UTSW	9	106080547	missense	probably damaging	1.00
R0490:Col6a4	UTSW	9	106013770	missense	probably damaging	0.99
R0621:Col6a4	UTSW	9	106066791	missense	probably damaging	0.97
R0667:Col6a4	UTSW	9	106029959	splice site	probably benign
R0681:Col6a4	UTSW	9	106067144	nonsense	probably null
R0690:Col6a4	UTSW	9	106028187	splice site	probably benign
R0714:Col6a4	UTSW	9	106017903	unclassified	probably benign
R0788:Col6a4	UTSW	9	106071998	missense	probably benign	0.15
R1036:Col6a4	UTSW	9	106068198	missense	probably damaging	1.00
R1296:Col6a4	UTSW	9	106062853	missense	possibly damaging	0.47
R1386:Col6a4	UTSW	9	106062945	missense	probably benign	0.15
R1484:Col6a4	UTSW	9	106013302	critical splice donor site	probably null
R1528:Col6a4	UTSW	9	106075220	missense	probably damaging	0.99
R1555:Col6a4	UTSW	9	106000886	missense	possibly damaging	0.93
R1622:Col6a4	UTSW	9	105997135	missense	probably benign	0.01
R1653:Col6a4	UTSW	9	106072409	missense	probably damaging	0.99
R1720:Col6a4	UTSW	9	106026472	missense	probably damaging	1.00
R1768:Col6a4	UTSW	9	106080100	missense	probably benign
R1941:Col6a4	UTSW	9	106075010	missense	probably benign	0.00
R2092:Col6a4	UTSW	9	106060331	missense	probably damaging	1.00
R2134:Col6a4	UTSW	9	106066661	missense	probably benign	0.09
R2149:Col6a4	UTSW	9	106076929	missense	probably benign	0.00
R2174:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2204:Col6a4	UTSW	9	106060132	missense	probably damaging	0.98
R2248:Col6a4	UTSW	9	106079959	missense	probably benign	0.15
R3750:Col6a4	UTSW	9	106020665	critical splice acceptor site	probably null
R3751:Col6a4	UTSW	9	106072114	missense	probably damaging	0.98
R3776:Col6a4	UTSW	9	106051701	nonsense	probably null
R3872:Col6a4	UTSW	9	106013659	missense	possibly damaging	0.95
R4043:Col6a4	UTSW	9	106072411	nonsense	probably null
R4056:Col6a4	UTSW	9	106026466	missense	probably damaging	0.98
R4212:Col6a4	UTSW	9	106075370	missense	probably benign	0.28
R4417:Col6a4	UTSW	9	106072016	missense	probably damaging	0.99
R4683:Col6a4	UTSW	9	106080130	missense	probably benign	0.00
R4719:Col6a4	UTSW	9	106068252	missense	probably damaging	0.99
R4791:Col6a4	UTSW	9	106080202	missense	possibly damaging	0.68
R4833:Col6a4	UTSW	9	106071979	missense	probably benign	0.00
R4886:Col6a4	UTSW	9	106060072	missense	probably benign	0.00
R4998:Col6a4	UTSW	9	105990778	utr 3 prime	probably benign
R5091:Col6a4	UTSW	9	106075063	missense	probably damaging	1.00
R5113:Col6a4	UTSW	9	106066960	missense	possibly damaging	0.89
R5129:Col6a4	UTSW	9	106013377	missense	probably damaging	0.98
R5231:Col6a4	UTSW	9	106025531	missense	probably damaging	0.96
R5297:Col6a4	UTSW	9	106074867	missense	probably benign	0.02
R5352:Col6a4	UTSW	9	106061544	missense	probably damaging	1.00
R5438:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5518:Col6a4	UTSW	9	106072188	missense	possibly damaging	0.68
R5657:Col6a4	UTSW	9	106072198	missense	probably damaging	0.99
R5660:Col6a4	UTSW	9	105996116	missense	probably benign	0.01
R5662:Col6a4	UTSW	9	106068001	missense	probably damaging	0.99
R5777:Col6a4	UTSW	9	106013696	missense	possibly damaging	0.95
R5800:Col6a4	UTSW	9	106080275	missense	probably damaging	0.99
R5929:Col6a4	UTSW	9	106063044	missense	probably benign	0.15
R5999:Col6a4	UTSW	9	106067921	missense	probably benign	0.11
R6243:Col6a4	UTSW	9	106013390	missense	possibly damaging	0.95
R6285:Col6a4	UTSW	9	106074986	missense	probably damaging	0.96
R6288:Col6a4	UTSW	9	106068263	missense	probably damaging	0.99
R6361:Col6a4	UTSW	9	106066703	missense	probably benign	0.28
R6485:Col6a4	UTSW	9	106076870	critical splice donor site	probably null
R6490:Col6a4	UTSW	9	106074992	nonsense	probably null
R6537:Col6a4	UTSW	9	106067954	missense	possibly damaging	0.87
R6598:Col6a4	UTSW	9	106000412	missense	probably damaging	0.99
R6643:Col6a4	UTSW	9	106000631	missense	probably damaging	0.96
R6905:Col6a4	UTSW	9	106060318	splice site	probably null
R6944:Col6a4	UTSW	9	106072171	missense	probably damaging	0.98
R7015:Col6a4	UTSW	9	106033755	critical splice donor site	probably null
R7027:Col6a4	UTSW	9	106067014	missense	probably damaging	1.00
R7088:Col6a4	UTSW	9	106000686	missense	possibly damaging	0.56
R7200:Col6a4	UTSW	9	106072249	missense	possibly damaging	0.68
R7238:Col6a4	UTSW	9	106000320	missense	probably damaging	0.99
R7273:Col6a4	UTSW	9	106000457	missense	possibly damaging	0.92
R7335:Col6a4	UTSW	9	106076892	missense	possibly damaging	0.90
R7418:Col6a4	UTSW	9	106022915	missense	probably damaging	1.00
R7421:Col6a4	UTSW	9	106020795	missense	probably damaging	0.99
R7530:Col6a4	UTSW	9	106068390	missense	probably damaging	0.99
R7600:Col6a4	UTSW	9	106066999	missense	possibly damaging	0.86
R7701:Col6a4	UTSW	9	106082888	missense	probably benign	0.17
R7830:Col6a4	UTSW	9	106075390	missense	probably damaging	0.99
R7881:Col6a4	UTSW	9	106080298	missense	probably benign	0.14
R8157:Col6a4	UTSW	9	106067898	missense	possibly damaging	0.92
R8292:Col6a4	UTSW	9	106076877	missense	probably benign	0.01
R8309:Col6a4	UTSW	9	106075215	missense	probably benign	0.08
R8336:Col6a4	UTSW	9	106075329	missense	possibly damaging	0.65
R8359:Col6a4	UTSW	9	106068384	missense	probably benign	0.00
R8530:Col6a4	UTSW	9	106080505	missense	probably benign	0.31
R8556:Col6a4	UTSW	9	106067053	missense	probably damaging	0.96
R8832:Col6a4	UTSW	9	106072154	missense	probably benign
R9001:Col6a4	UTSW	9	106067171	missense	probably benign	0.26
R9009:Col6a4	UTSW	9	106077205	missense	probably benign	0.38
R9069:Col6a4	UTSW	9	106074939	missense	possibly damaging	0.85
R9155:Col6a4	UTSW	9	106075010	missense	probably benign
R9175:Col6a4	UTSW	9	106080361	missense	probably benign
R9176:Col6a4	UTSW	9	106061556	missense	probably damaging	1.00
R9295:Col6a4	UTSW	9	106080535	missense	probably damaging	1.00
R9298:Col6a4	UTSW	9	106068335	missense	probably damaging	0.96
R9389:Col6a4	UTSW	9	106000784	missense	probably damaging	1.00
R9424:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
R9576:Col6a4	UTSW	9	106068072	missense	probably benign	0.30
RF022:Col6a4	UTSW	9	106077008	missense	probably damaging	0.99
X0025:Col6a4	UTSW	9	106000455	missense	probably damaging	0.99
Z1176:Col6a4	UTSW	9	106000797	missense	probably benign
Z1176:Col6a4	UTSW	9	106000870	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTTTACAGAACCCTGATGCAC -3'
(R):5'- GGCACAGCAAGGTGTACTTTG -3'

Sequencing Primer
(F):5'- CTGATGCACCAAGAACTTCTGGATG -3'
(R):5'- GCACAGCAAGGTGTACTTTGTATCAG -3'

Posted On

2014-12-04