Incidental Mutation 'R2568:Col6a4'
ID254639
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106063076 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1218 (D1218E)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121963
AA Change: D1218E

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: D1218E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTACAGAACCCTGATGCAC -3'
(R):5'- GGCACAGCAAGGTGTACTTTG -3'

Sequencing Primer
(F):5'- CTGATGCACCAAGAACTTCTGGATG -3'
(R):5'- GCACAGCAAGGTGTACTTTGTATCAG -3'
Posted On2014-12-04