Mutagenetix > Incidental Mutations

Incidental Mutation 'R0317:Pgr'

25464

Institutional Source

Beutler Lab

Gene Symbol

Pgr

Ensembl Gene

ENSMUSG00000031870

Gene Name

progesterone receptor

Synonyms

9930019P03Rik, ENSMUSG00000074510, PR-A, PR-B, PR, NR3C3

MMRRC Submission

038527-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.418) question?

Stock #

R0317 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8899833-8968611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8965022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 889 (I889F)

Ref Sequence

ENSEMBL: ENSMUSP00000140124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070463] [ENSMUST00000098986] [ENSMUST00000189181]

AlphaFold

Q00175

Predicted Effect

probably benign
Transcript: ENSMUST00000070463
AA Change: I889F

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000063562
Gene: ENSMUSG00000031870
AA Change: I889F

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	108	120	N/A	INTRINSIC
low complexity region	244	265	N/A	INTRINSIC
low complexity region	337	354	N/A	INTRINSIC
low complexity region	418	431	N/A	INTRINSIC
low complexity region	434	454	N/A	INTRINSIC
low complexity region	493	503	N/A	INTRINSIC
low complexity region	505	519	N/A	INTRINSIC
ZnF_C4	557	628	1.29e-29	SMART
low complexity region	703	711	N/A	INTRINSIC
HOLI	713	877	3.21e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098986
AA Change: I724F

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000096584
Gene: ENSMUSG00000031870
AA Change: I724F

Domain	Start	End	E-Value	Type
low complexity region	79	100	N/A	INTRINSIC
low complexity region	172	189	N/A	INTRINSIC
low complexity region	253	266	N/A	INTRINSIC
low complexity region	269	289	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	340	354	N/A	INTRINSIC
ZnF_C4	392	463	1.29e-29	SMART
low complexity region	538	546	N/A	INTRINSIC
HOLI	548	712	3.21e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189181
AA Change: I889F

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140124
Gene: ENSMUSG00000031870
AA Change: I889F

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	108	120	N/A	INTRINSIC
low complexity region	244	265	N/A	INTRINSIC
low complexity region	337	354	N/A	INTRINSIC
low complexity region	418	431	N/A	INTRINSIC
low complexity region	434	454	N/A	INTRINSIC
low complexity region	493	503	N/A	INTRINSIC
low complexity region	505	519	N/A	INTRINSIC
ZnF_C4	557	628	1.29e-29	SMART
low complexity region	703	711	N/A	INTRINSIC
HOLI	713	877	3.21e-34	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null female mice are sterile and exhibit ovulatory defects, uterine hyperplasia, and impaired mammary development. Females lacking only isoform A are infertile but show normal mammary development, while females lacking only isoform B are fertile but present with mammary developmental defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,293,459	V1774A	probably damaging	Het
Adam34	G	A	8: 43,652,251	P119L	probably benign	Het
Ap3b2	T	C	7: 81,463,681		probably null	Het
Arfip2	G	A	7: 105,637,223	T124M	probably damaging	Het
Arhgef26	T	C	3: 62,423,544	S560P	probably damaging	Het
Bcl11a	A	T	11: 24,172,697		probably null	Het
Cab39	A	G	1: 85,849,160	E322G	probably damaging	Het
Cad	C	A	5: 31,072,321	P1382Q	probably benign	Het
Cc2d2a	T	C	5: 43,706,901		probably null	Het
Cela2a	A	T	4: 141,821,700		probably null	Het
Ces1e	A	C	8: 93,224,039	I38S	probably benign	Het
Ces1f	A	T	8: 93,263,391	F364I	probably benign	Het
Chgb	A	G	2: 132,793,811	T558A	probably benign	Het
Cnpy4	C	T	5: 138,192,812	Q217*	probably null	Het
Col4a3bp	C	T	13: 96,634,121	R487*	probably null	Het
Crlf1	A	G	8: 70,498,599	T43A	probably benign	Het
Dnah7b	T	A	1: 46,134,656	M707K	probably damaging	Het
Ets2	G	A	16: 95,712,149	S123N	probably damaging	Het
Fam196b	C	A	11: 34,402,826	D289E	possibly damaging	Het
Fry	T	C	5: 150,471,468	F304S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,116	R120H	probably benign	Het
Gbf1	A	G	19: 46,254,020	T96A	probably benign	Het
Ggn	T	A	7: 29,171,090	M1K	probably null	Het
Gm5239	A	G	18: 35,536,916	T112A	probably benign	Het
Kif1bp	A	T	10: 62,578,082		probably null	Het
Lrrc15	A	T	16: 30,273,743	H259Q	probably benign	Het
Lysmd4	A	G	7: 67,226,297	Y236C	probably damaging	Het
Med29	T	C	7: 28,386,859	T175A	possibly damaging	Het
Mfsd12	G	T	10: 81,357,799	D68Y	probably damaging	Het
Myh1	T	C	11: 67,217,512	L1308P	probably damaging	Het
Nphp4	T	A	4: 152,551,931		probably null	Het
Olfr948	A	G	9: 39,319,461	I51T	probably benign	Het
Pdhx	A	G	2: 103,028,280	V393A	probably benign	Het
Pgm5	A	G	19: 24,824,399	I155T	possibly damaging	Het
Phactr4	T	A	4: 132,386,930	K51I	probably damaging	Het
Pum2	T	A	12: 8,728,754	I468K	possibly damaging	Het
Rab11a	A	G	9: 64,725,553	S24P	probably damaging	Het
Rasef	T	C	4: 73,748,562	Q160R	probably damaging	Het
Rbl2	A	G	8: 91,087,144	D339G	probably benign	Het
Recql5	A	G	11: 115,894,673	S666P	probably benign	Het
Rfc1	A	T	5: 65,296,052		probably null	Het
Scarb1	A	G	5: 125,289,692	V59A	probably damaging	Het
Slc2a4	C	T	11: 69,946,356	V85M	probably damaging	Het
Slc6a12	A	G	6: 121,358,625	I291V	possibly damaging	Het
Slco3a1	A	C	7: 74,504,426	Y104D	probably damaging	Het
Suz12	T	A	11: 79,999,078	D13E	probably damaging	Het
Tlr1	G	T	5: 64,925,967	C422*	probably null	Het
Tmco1	T	C	1: 167,325,893	V114A	probably damaging	Het
Trpa1	T	C	1: 14,881,632	T948A	probably benign	Het
Tub	A	T	7: 109,020,927	N93Y	probably damaging	Het
Ufsp2	G	A	8: 45,992,233		probably null	Het
Veph1	T	C	3: 66,171,975	D373G	probably benign	Het
Vmn1r206	A	G	13: 22,620,960	S26P	possibly damaging	Het
Vmn2r1	T	C	3: 64,081,819	S60P	possibly damaging	Het
Wdcp	A	G	12: 4,851,583	S480G	probably benign	Het
Wnk4	T	C	11: 101,268,804	S612P	probably benign	Het
Zfp503	T	C	14: 21,986,459	K130E	probably benign	Het
Zkscan16	G	A	4: 58,957,602	C628Y	possibly damaging	Het

Other mutations in Pgr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01610:Pgr	APN	9	8903691	missense	possibly damaging	0.71
IGL01772:Pgr	APN	9	8946636	splice site	probably benign
IGL01963:Pgr	APN	9	8922668	missense	probably damaging	0.97
IGL02033:Pgr	APN	9	8965110	missense	probably damaging	1.00
IGL02837:Pgr	APN	9	8946638	splice site	probably benign
IGL03070:Pgr	APN	9	8903664	missense	possibly damaging	0.86
IGL03300:Pgr	APN	9	8961539	missense	probably damaging	1.00
R0152:Pgr	UTSW	9	8965022	missense	probably benign	0.45
R0305:Pgr	UTSW	9	8902087	splice site	probably benign
R0467:Pgr	UTSW	9	8900778	missense	possibly damaging	0.92
R1673:Pgr	UTSW	9	8902068	missense	possibly damaging	0.71
R1711:Pgr	UTSW	9	8922714	splice site	probably null
R1928:Pgr	UTSW	9	8903629	nonsense	probably null
R1951:Pgr	UTSW	9	8946953	splice site	probably benign
R2023:Pgr	UTSW	9	8958398	missense	probably damaging	0.99
R2426:Pgr	UTSW	9	8900717	missense	probably damaging	0.98
R2967:Pgr	UTSW	9	8901818	missense	possibly damaging	0.86
R3105:Pgr	UTSW	9	8958396	missense	probably benign	0.02
R3440:Pgr	UTSW	9	8922629	missense	probably damaging	0.98
R3735:Pgr	UTSW	9	8901533	missense	probably damaging	0.99
R3947:Pgr	UTSW	9	8961452	missense	probably benign	0.25
R4398:Pgr	UTSW	9	8903749	critical splice donor site	probably null
R4497:Pgr	UTSW	9	8958419	missense	probably damaging	0.99
R4811:Pgr	UTSW	9	8900843	nonsense	probably null
R4907:Pgr	UTSW	9	8947043	intron	probably benign
R4996:Pgr	UTSW	9	8900913	missense	probably damaging	0.99
R5448:Pgr	UTSW	9	8922637	missense	probably benign	0.06
R5449:Pgr	UTSW	9	8956343	missense	possibly damaging	0.95
R5699:Pgr	UTSW	9	8900599	start gained	probably benign
R5764:Pgr	UTSW	9	8900537	missense	probably benign	0.00
R6057:Pgr	UTSW	9	8902005	missense	probably damaging	0.98
R6134:Pgr	UTSW	9	8900739	missense	possibly damaging	0.51
R6242:Pgr	UTSW	9	8900979	missense	probably benign
R6476:Pgr	UTSW	9	8964838	splice site	probably null
R6508:Pgr	UTSW	9	8956289	missense	probably damaging	1.00
R6604:Pgr	UTSW	9	8946866	missense	possibly damaging	0.73
R6715:Pgr	UTSW	9	8964999	missense	possibly damaging	0.93
R7444:Pgr	UTSW	9	8946882	missense	probably damaging	1.00
R7769:Pgr	UTSW	9	8946855	missense	possibly damaging	0.88
R7899:Pgr	UTSW	9	8903742	missense	probably benign	0.11
R8139:Pgr	UTSW	9	8956340	missense	possibly damaging	0.61
R8198:Pgr	UTSW	9	8958410	missense	possibly damaging	0.84
R8348:Pgr	UTSW	9	8922601	missense	probably benign	0.32
R8713:Pgr	UTSW	9	8900817	missense	possibly damaging	0.92
R8725:Pgr	UTSW	9	8901543	missense	probably damaging	0.99
R8727:Pgr	UTSW	9	8901543	missense	probably damaging	0.99
R8748:Pgr	UTSW	9	8958448	missense	probably benign	0.19
X0066:Pgr	UTSW	9	8900834	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- AACCATTTCCACATTACCCTGGAGC -3'
(R):5'- CACATGACCTGACCATCCTGACTG -3'

Sequencing Primer
(F):5'- CACATTACCCTGGAGCATGGAG -3'
(R):5'- TGACCATCCTGACTGAGAAAAAG -3'

Posted On

2013-04-16