Incidental Mutation 'R2568:Clasp2'
ID 254641
Institutional Source Beutler Lab
Gene Symbol Clasp2
Ensembl Gene ENSMUSG00000033392
Gene Name CLIP associating protein 2
Synonyms CLASP2alpha, 1500004F14Rik, CLASP2gamma, CLASP2, CLASP2beta, 8030404L10Rik
MMRRC Submission 040427-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2568 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 113570541-113748750 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113707832 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 614 (I614M)
Ref Sequence ENSEMBL: ENSMUSP00000149670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000111838
AA Change: I596M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: I596M

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 877 2.03e-1 SMART
low complexity region 995 1009 N/A INTRINSIC
TOG 1043 1274 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163895
AA Change: I617M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: I617M

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166734
AA Change: I596M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: I596M

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213663
Predicted Effect probably benign
Transcript: ENSMUST00000214522
AA Change: I614M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215022
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730071L15Rik A T 11: 6,150,161 (GRCm39) probably benign Het
Abca13 A T 11: 9,283,310 (GRCm39) N3244I probably benign Het
Adgrf5 A G 17: 43,748,562 (GRCm39) T219A probably damaging Het
Adgrg5 A T 8: 95,660,649 (GRCm39) N92I probably damaging Het
Agt A C 8: 125,283,694 (GRCm39) V475G probably damaging Het
Akap6 A G 12: 52,934,061 (GRCm39) K518E possibly damaging Het
Apoh T G 11: 108,295,697 (GRCm39) D133E probably benign Het
Axdnd1 T A 1: 156,220,319 (GRCm39) M234L possibly damaging Het
Cacna1d A G 14: 29,804,468 (GRCm39) I1335T probably damaging Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 (GRCm39) K444* probably null Het
Col6a4 A T 9: 105,940,275 (GRCm39) D1218E possibly damaging Het
Cplane1 T C 15: 8,230,753 (GRCm39) V1010A possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
D130043K22Rik C T 13: 25,067,874 (GRCm39) T870M probably damaging Het
Dagla C A 19: 10,225,516 (GRCm39) A883S probably benign Het
Dhx30 A G 9: 109,926,263 (GRCm39) V87A probably damaging Het
Dtx1 C A 5: 120,848,249 (GRCm39) V44L possibly damaging Het
Ecm2 T A 13: 49,683,605 (GRCm39) S528T possibly damaging Het
Eeig2 T A 3: 108,886,164 (GRCm39) N356I probably benign Het
Egfem1 A T 3: 29,637,080 (GRCm39) N172I probably damaging Het
Fam13a T G 6: 58,912,594 (GRCm39) R686S probably damaging Het
Fam243 A G 16: 92,118,207 (GRCm39) L27P probably damaging Het
Fmo1 T A 1: 162,663,828 (GRCm39) I234L probably benign Het
Foxj2 C T 6: 122,805,331 (GRCm39) R68W probably damaging Het
Foxo6 A T 4: 120,125,961 (GRCm39) M278K probably benign Het
Fsip2 A G 2: 82,820,775 (GRCm39) S5503G probably benign Het
Gdf5 C G 2: 155,784,010 (GRCm39) R100G probably benign Het
Il1b A T 2: 129,209,242 (GRCm39) D129E probably damaging Het
Klhl29 A G 12: 5,141,350 (GRCm39) S545P probably damaging Het
Krt87 G T 15: 101,385,708 (GRCm39) R296S possibly damaging Het
Llgl1 T G 11: 60,599,638 (GRCm39) S509R probably damaging Het
Lmod1 A T 1: 135,291,702 (GRCm39) K186* probably null Het
Lrpprc C T 17: 85,034,077 (GRCm39) A973T probably damaging Het
Marco T C 1: 120,422,514 (GRCm39) H49R possibly damaging Het
Mylk4 T C 13: 32,906,001 (GRCm39) N394S probably null Het
Myo5a A G 9: 75,030,322 (GRCm39) Y147C probably damaging Het
Myo5a T C 9: 75,059,179 (GRCm39) V469A probably damaging Het
Myot A G 18: 44,470,283 (GRCm39) T87A probably benign Het
Nav2 A G 7: 49,247,312 (GRCm39) H2154R probably damaging Het
Nek10 A G 14: 14,999,112 (GRCm38) E1037G possibly damaging Het
Or1j13 T C 2: 36,369,986 (GRCm39) D52G probably damaging Het
Or52e4 A G 7: 104,705,878 (GRCm39) T142A probably benign Het
Or5k17 A G 16: 58,746,286 (GRCm39) V216A probably benign Het
Pitrm1 G T 13: 6,625,128 (GRCm39) V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,976,940 (GRCm39) probably benign Het
Prdx1 T G 4: 116,550,997 (GRCm39) I156S probably benign Het
Rbks T A 5: 31,823,096 (GRCm39) T107S probably damaging Het
Ryr3 G A 2: 112,506,219 (GRCm39) R3468W probably damaging Het
Scn1a C T 2: 66,103,813 (GRCm39) D1805N probably damaging Het
Sirpa T C 2: 129,457,568 (GRCm39) V214A probably benign Het
Slc35c1 T C 2: 92,289,225 (GRCm39) N94D probably benign Het
Sorbs2 A T 8: 46,248,407 (GRCm39) K553* probably null Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Thg1l A G 11: 45,842,392 (GRCm39) V142A probably benign Het
Tiparp T A 3: 65,460,551 (GRCm39) Y513* probably null Het
Tmc6 A G 11: 117,663,646 (GRCm39) V522A probably benign Het
Trim39 T A 17: 36,580,056 (GRCm39) probably benign Het
Trrap G A 5: 144,780,179 (GRCm39) probably null Het
Tulp3 C T 6: 128,304,601 (GRCm39) V218I probably benign Het
Vmn1r38 T A 6: 66,753,955 (GRCm39) I54F probably benign Het
Vmn2r23 T A 6: 123,719,147 (GRCm39) Y833* probably null Het
Zfp810 A T 9: 22,190,534 (GRCm39) S125T probably benign Het
Other mutations in Clasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Clasp2 APN 9 113,735,060 (GRCm39) splice site probably benign
IGL00885:Clasp2 APN 9 113,740,484 (GRCm39) missense probably damaging 1.00
IGL01314:Clasp2 APN 9 113,735,195 (GRCm39) missense possibly damaging 0.89
IGL01344:Clasp2 APN 9 113,642,360 (GRCm39) splice site probably null
IGL01567:Clasp2 APN 9 113,709,164 (GRCm39) missense probably damaging 1.00
IGL02238:Clasp2 APN 9 113,709,088 (GRCm39) missense probably damaging 1.00
IGL02299:Clasp2 APN 9 113,709,057 (GRCm39) missense probably damaging 1.00
IGL02323:Clasp2 APN 9 113,697,794 (GRCm39) splice site probably benign
IGL02635:Clasp2 APN 9 113,737,910 (GRCm39) missense probably damaging 0.98
IGL02645:Clasp2 APN 9 113,719,129 (GRCm39) missense probably damaging 1.00
IGL02976:Clasp2 APN 9 113,735,204 (GRCm39) missense probably damaging 1.00
IGL03190:Clasp2 APN 9 113,673,208 (GRCm39) nonsense probably null
IGL03219:Clasp2 APN 9 113,677,545 (GRCm39) splice site probably benign
PIT4810001:Clasp2 UTSW 9 113,735,135 (GRCm39) missense probably damaging 1.00
R0067:Clasp2 UTSW 9 113,689,209 (GRCm39) splice site probably benign
R0067:Clasp2 UTSW 9 113,689,209 (GRCm39) splice site probably benign
R0421:Clasp2 UTSW 9 113,683,370 (GRCm39) missense probably benign 0.02
R0432:Clasp2 UTSW 9 113,738,487 (GRCm39) missense probably benign 0.00
R0458:Clasp2 UTSW 9 113,735,292 (GRCm39) splice site probably null
R0865:Clasp2 UTSW 9 113,740,568 (GRCm39) missense possibly damaging 0.57
R0972:Clasp2 UTSW 9 113,676,773 (GRCm39) missense possibly damaging 0.58
R1037:Clasp2 UTSW 9 113,725,702 (GRCm39) splice site probably benign
R1925:Clasp2 UTSW 9 113,735,265 (GRCm39) missense possibly damaging 0.88
R2015:Clasp2 UTSW 9 113,740,568 (GRCm39) missense possibly damaging 0.57
R2066:Clasp2 UTSW 9 113,735,225 (GRCm39) missense possibly damaging 0.86
R2330:Clasp2 UTSW 9 113,705,372 (GRCm39) missense probably damaging 1.00
R3011:Clasp2 UTSW 9 113,730,581 (GRCm39) missense probably damaging 1.00
R3879:Clasp2 UTSW 9 113,719,029 (GRCm39) missense probably damaging 0.98
R3915:Clasp2 UTSW 9 113,737,805 (GRCm39) missense probably damaging 0.99
R3928:Clasp2 UTSW 9 113,735,173 (GRCm39) missense probably benign 0.28
R4323:Clasp2 UTSW 9 113,719,027 (GRCm39) missense possibly damaging 0.91
R4571:Clasp2 UTSW 9 113,676,789 (GRCm39) missense probably damaging 1.00
R4975:Clasp2 UTSW 9 113,732,984 (GRCm39) missense probably damaging 1.00
R5445:Clasp2 UTSW 9 113,733,014 (GRCm39) missense probably damaging 1.00
R5564:Clasp2 UTSW 9 113,641,836 (GRCm39) critical splice donor site probably null
R5697:Clasp2 UTSW 9 113,689,190 (GRCm39) missense probably benign 0.01
R5780:Clasp2 UTSW 9 113,679,220 (GRCm39) missense probably damaging 0.99
R5787:Clasp2 UTSW 9 113,691,310 (GRCm39) missense probably damaging 1.00
R6011:Clasp2 UTSW 9 113,705,315 (GRCm39) missense probably benign 0.07
R6026:Clasp2 UTSW 9 113,740,646 (GRCm39) missense probably benign 0.13
R6090:Clasp2 UTSW 9 113,681,803 (GRCm39) missense probably benign 0.06
R6262:Clasp2 UTSW 9 113,705,420 (GRCm39) critical splice donor site probably null
R6427:Clasp2 UTSW 9 113,721,512 (GRCm39) missense probably damaging 1.00
R6464:Clasp2 UTSW 9 113,602,785 (GRCm39) missense probably damaging 1.00
R6586:Clasp2 UTSW 9 113,642,332 (GRCm39) missense probably damaging 1.00
R6628:Clasp2 UTSW 9 113,725,788 (GRCm39) missense probably damaging 1.00
R6745:Clasp2 UTSW 9 113,704,338 (GRCm39) nonsense probably null
R7032:Clasp2 UTSW 9 113,683,391 (GRCm39) missense probably benign 0.04
R7165:Clasp2 UTSW 9 113,615,467 (GRCm39) splice site probably null
R7221:Clasp2 UTSW 9 113,681,825 (GRCm39) missense probably damaging 0.99
R7336:Clasp2 UTSW 9 113,705,421 (GRCm39) splice site probably null
R7583:Clasp2 UTSW 9 113,737,755 (GRCm39) missense probably benign 0.02
R7774:Clasp2 UTSW 9 113,677,804 (GRCm39) splice site probably null
R7895:Clasp2 UTSW 9 113,733,016 (GRCm39) missense probably benign 0.03
R8084:Clasp2 UTSW 9 113,676,823 (GRCm39) missense probably benign 0.16
R8109:Clasp2 UTSW 9 113,740,588 (GRCm39) missense probably damaging 1.00
R8171:Clasp2 UTSW 9 113,732,974 (GRCm39) missense possibly damaging 0.88
R8230:Clasp2 UTSW 9 113,721,482 (GRCm39) missense possibly damaging 0.73
R8810:Clasp2 UTSW 9 113,728,649 (GRCm39) missense probably damaging 1.00
R8879:Clasp2 UTSW 9 113,602,773 (GRCm39) missense probably benign 0.39
R8888:Clasp2 UTSW 9 113,732,936 (GRCm39) missense possibly damaging 0.54
R8889:Clasp2 UTSW 9 113,709,251 (GRCm39) missense probably damaging 1.00
R8892:Clasp2 UTSW 9 113,709,251 (GRCm39) missense probably damaging 1.00
R8922:Clasp2 UTSW 9 113,725,728 (GRCm39) nonsense probably null
R9042:Clasp2 UTSW 9 113,735,065 (GRCm39) missense probably benign
R9195:Clasp2 UTSW 9 113,671,045 (GRCm39) missense probably benign 0.06
R9355:Clasp2 UTSW 9 113,664,309 (GRCm39) missense probably damaging 1.00
R9481:Clasp2 UTSW 9 113,670,669 (GRCm39) missense probably damaging 1.00
R9502:Clasp2 UTSW 9 113,737,866 (GRCm39) missense probably benign 0.01
R9523:Clasp2 UTSW 9 113,705,372 (GRCm39) missense probably damaging 0.98
R9525:Clasp2 UTSW 9 113,740,677 (GRCm39) missense probably damaging 1.00
R9653:Clasp2 UTSW 9 113,670,993 (GRCm39) missense probably benign 0.01
R9699:Clasp2 UTSW 9 113,738,614 (GRCm39) critical splice donor site probably null
R9738:Clasp2 UTSW 9 113,590,665 (GRCm39) nonsense probably null
R9775:Clasp2 UTSW 9 113,725,740 (GRCm39) missense probably benign
X0022:Clasp2 UTSW 9 113,681,740 (GRCm39) missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113,599,289 (GRCm39) missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113,737,863 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTCTCTAAATGGAAGGACACTG -3'
(R):5'- AAGTGGCACCTCCCTAAGAC -3'

Sequencing Primer
(F):5'- CTGACAGGACTAGAGATAACCCTG -3'
(R):5'- AGACACTATGTTCAGTCAGTATCCC -3'
Posted On 2014-12-04