Incidental Mutation 'R2568:Thg1l'
ID254643
Institutional Source Beutler Lab
Gene Symbol Thg1l
Ensembl Gene ENSMUSG00000011254
Gene NametRNA-histidine guanylyltransferase 1-like (S. cerevisiae)
Synonyms5730409G07Rik, 1700121M19Rik
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location45946843-45955494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45951565 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000104877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011398] [ENSMUST00000109254]
Predicted Effect probably benign
Transcript: ENSMUST00000011398
AA Change: V202A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000011398
Gene: ENSMUSG00000011254
AA Change: V202A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Thg1 35 164 1e-53 PFAM
Pfam:Thg1C 167 283 2.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109254
AA Change: V142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104877
Gene: ENSMUSG00000011254
AA Change: V142A

DomainStartEndE-ValueType
Pfam:Thg1 2 104 2.1e-37 PFAM
Pfam:Thg1C 105 235 6.5e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133851
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial protein that is induced by high levels of glucose and is associated with diabetic nephropathy. The encoded protein appears to increase mitochondrial biogenesis, which could lead to renal fibrosis. Another function of this protein is that of a guanyltransferase, adding GMP to the 5' end of tRNA(His). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Thg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Thg1l APN 11 45954221 missense probably benign 0.02
IGL01111:Thg1l APN 11 45948224 missense probably damaging 0.98
IGL01899:Thg1l APN 11 45954191 missense probably damaging 0.96
IGL02097:Thg1l APN 11 45950228 missense probably benign 0.09
IGL02746:Thg1l APN 11 45948227 nonsense probably null
R0547:Thg1l UTSW 11 45954191 missense probably damaging 1.00
R1099:Thg1l UTSW 11 45954161 missense possibly damaging 0.76
R1998:Thg1l UTSW 11 45950203 missense possibly damaging 0.95
R4738:Thg1l UTSW 11 45954191 missense probably damaging 1.00
R5614:Thg1l UTSW 11 45950227 missense possibly damaging 0.65
R6191:Thg1l UTSW 11 45954161 missense probably benign 0.03
R7703:Thg1l UTSW 11 45955293 missense probably damaging 1.00
R8218:Thg1l UTSW 11 45955450 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAACCGACTCTGCTGACCAC -3'
(R):5'- GAGAGAAGCTGGGTTGTGATATTCC -3'

Sequencing Primer
(F):5'- TCTGCTGACCACAAGCAAGG -3'
(R):5'- GGTTGTGATATTCCTGGAAACATAAG -3'
Posted On2014-12-04