Incidental Mutation 'R2568:Klhl29'
ID254648
Institutional Source Beutler Lab
Gene Symbol Klhl29
Ensembl Gene ENSMUSG00000020627
Gene Namekelch-like 29
SynonymsA230106N14Rik, Kbtbd9
MMRRC Submission 040427-MU
Accession Numbers

Genbank: NM_001164493; MGI: 2683857

Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location5077472-5375682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5091350 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 545 (S545P)
Ref Sequence ENSEMBL: ENSMUSP00000020958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]
Predicted Effect probably damaging
Transcript: ENSMUST00000020958
AA Change: S545P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: S545P

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 50 75 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
BTB 329 431 2.07e-22 SMART
BACK 436 538 4.88e-32 SMART
Kelch 585 636 5.33e0 SMART
Kelch 637 683 5.42e-5 SMART
Kelch 684 730 5.42e-5 SMART
Kelch 731 778 5.44e-1 SMART
Kelch 779 821 2.54e-1 SMART
Kelch 822 870 4.01e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218384
AA Change: S545P

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Klhl29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Klhl29 APN 12 5140705 missense probably benign 0.01
IGL02639:Klhl29 APN 12 5137453 missense probably damaging 0.96
IGL03142:Klhl29 APN 12 5137603 missense probably damaging 1.00
bauxite UTSW 12 5091347 missense probably damaging 0.98
mineral UTSW 12 5083995 missense probably damaging 0.99
tungsten UTSW 12 5090995 nonsense probably null
N/A - 535:Klhl29 UTSW 12 5084019 missense probably damaging 1.00
R0347:Klhl29 UTSW 12 5084354 missense probably damaging 0.97
R0622:Klhl29 UTSW 12 5081224 missense probably damaging 1.00
R0631:Klhl29 UTSW 12 5094883 missense probably benign 0.08
R0784:Klhl29 UTSW 12 5081251 missense probably damaging 1.00
R1157:Klhl29 UTSW 12 5090650 missense possibly damaging 0.89
R1521:Klhl29 UTSW 12 5091307 missense probably damaging 1.00
R1535:Klhl29 UTSW 12 5084486 missense probably damaging 1.00
R1599:Klhl29 UTSW 12 5093538 missense probably damaging 1.00
R2049:Klhl29 UTSW 12 5137876 missense probably damaging 0.96
R2883:Klhl29 UTSW 12 5084036 missense probably damaging 1.00
R3724:Klhl29 UTSW 12 5090603 missense probably damaging 0.99
R3951:Klhl29 UTSW 12 5140660 missense probably damaging 1.00
R5031:Klhl29 UTSW 12 5091334 missense probably benign 0.05
R5078:Klhl29 UTSW 12 5093530 missense possibly damaging 0.82
R5410:Klhl29 UTSW 12 5091366 missense probably benign 0.36
R5619:Klhl29 UTSW 12 5140587 missense probably benign 0.23
R5681:Klhl29 UTSW 12 5090669 missense possibly damaging 0.56
R6028:Klhl29 UTSW 12 5090995 nonsense probably null
R6294:Klhl29 UTSW 12 5083995 missense probably damaging 0.99
R6394:Klhl29 UTSW 12 5094830 nonsense probably null
R6394:Klhl29 UTSW 12 5137720 missense probably benign 0.00
R6475:Klhl29 UTSW 12 5091030 missense probably damaging 0.98
R6737:Klhl29 UTSW 12 5210124 missense possibly damaging 0.68
R6781:Klhl29 UTSW 12 5091347 missense probably damaging 0.98
R6788:Klhl29 UTSW 12 5084393 missense probably damaging 1.00
R7741:Klhl29 UTSW 12 5137500 missense possibly damaging 0.49
Z1177:Klhl29 UTSW 12 5081152 makesense probably null
Predicted Primers PCR Primer
(F):5'- CAGCATCTGTGTCTGGATCCTC -3'
(R):5'- TGTCTAGTATGCCAGGCTGG -3'

Sequencing Primer
(F):5'- TCTGGATCCTCTCTGGGGAGAC -3'
(R):5'- GGGCAATGTGCACTCCCAAG -3'
Posted On2014-12-04