Incidental Mutation 'R2568:D130043K22Rik'
ID254651
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene NameRIKEN cDNA D130043K22 gene
Synonyms
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24845135-24901270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24883891 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 870 (T870M)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
Predicted Effect probably damaging
Transcript: ENSMUST00000006893
AA Change: T870M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: T870M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141572
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169411
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ATGAAAATCCTGTGTCCTCTCC -3'
(R):5'- AGTCCAGACAACTGTTTGGC -3'

Sequencing Primer
(F):5'- CCCTCAGACCCCAAGAAGGATG -3'
(R):5'- TGTTTGGCTGATGAAAATTACAGAGG -3'
Posted On2014-12-04