Incidental Mutation 'R2568:Ecm2'
ID254653
Institutional Source Beutler Lab
Gene Symbol Ecm2
Ensembl Gene ENSMUSG00000043631
Gene Nameextracellular matrix protein 2, female organ and adipocyte specific
Synonymstenonectin, 9030618O22Rik
MMRRC Submission 040427-MU
Accession Numbers

Ncbi RefSeq: NM_001012324.2; MGI:3039578

Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49504810-49532789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49530129 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 528 (S528T)
Ref Sequence ENSEMBL: ENSMUSP00000060402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000051504]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000051504
AA Change: S528T

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060402
Gene: ENSMUSG00000043631
AA Change: S528T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
VWC 98 152 1.37e-11 SMART
coiled coil region 235 269 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
LRR 314 336 1.41e2 SMART
LRR 337 362 1.76e-1 SMART
LRR 363 386 5.41e0 SMART
LRR 408 433 1.91e1 SMART
LRR 434 457 4.98e-1 SMART
LRR 459 478 8.03e1 SMART
LRR 506 528 2.76e1 SMART
LRR 529 549 1.19e2 SMART
LRR 578 600 1.81e1 SMART
LRR 601 624 9.48e0 SMART
LRR 631 655 6.06e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222592
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ECM2 encodes extracellular matrix protein 2, so named because it shares extensive similarity with known extracelluar matrix proteins. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Marco T C 1: 120,494,785 H49R possibly damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Ecm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Ecm2 APN 13 49531318 missense probably benign 0.14
IGL01685:Ecm2 APN 13 49528898 missense probably damaging 1.00
IGL02070:Ecm2 APN 13 49518370 missense probably damaging 1.00
IGL02108:Ecm2 APN 13 49518444 nonsense probably null
IGL02138:Ecm2 APN 13 49522828 missense probably damaging 1.00
IGL02937:Ecm2 APN 13 49518476 missense probably damaging 0.99
IGL03350:Ecm2 APN 13 49520944 missense probably benign
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0627:Ecm2 UTSW 13 49521083 splice site probably benign
R1515:Ecm2 UTSW 13 49518332 missense possibly damaging 0.87
R1864:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1865:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1991:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2103:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2181:Ecm2 UTSW 13 49530289 missense probably damaging 1.00
R2209:Ecm2 UTSW 13 49530156 missense probably damaging 1.00
R4856:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R4867:Ecm2 UTSW 13 49531345 missense probably damaging 0.99
R4886:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R5368:Ecm2 UTSW 13 49520943 missense probably benign
R5420:Ecm2 UTSW 13 49527734 missense possibly damaging 0.65
R6084:Ecm2 UTSW 13 49515094 nonsense probably null
R6244:Ecm2 UTSW 13 49530307 missense probably damaging 1.00
R6881:Ecm2 UTSW 13 49530342 nonsense probably null
R6931:Ecm2 UTSW 13 49529011 missense probably benign 0.00
R7085:Ecm2 UTSW 13 49520902 missense probably damaging 1.00
R7347:Ecm2 UTSW 13 49515078 missense probably damaging 0.99
R7490:Ecm2 UTSW 13 49530342 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGTGTAAATGCTGGTAAGAGTATG -3'
(R):5'- AGCCTCAGAAAATGCAGTGC -3'

Sequencing Primer
(F):5'- TGCTGGTAAGAGTATGAGACTG -3'
(R):5'- CCTCAGAAAATGCAGTGCTTTCATG -3'
Posted On2014-12-04